авторефераты диссертаций www.z-pdf.ru
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
 

На правах рукописи

ШВЫРЕВА УЛЬЯНА СЕРГЕЕВНА

СТРУКТУРНО-ФЦНКЦИОНАЛЬНЫЙ АНАЛИЗ РЕГУЛЯТОРНОЙ

ОБЛАСТИ ГЕНА dps E. coli

03.00.03 – Молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Пущино-2016

доктор биологических наук, профессор

Озолинь Ольга Николаевна

кандидат биологических наук

Тутукина Мария Николаевна

доктор биологических наук, профессор

Гельфанд Михаил Сергеевич

(заместитель

директора

по

научным

Научные руководители:

Официальные оппоненты:

Ведущая организация:

вопросам

Федерального

государственного

бюджетного

учреждения

науки

Института

проблем

передачи

информации им. А.А. Харкевича Российской академии

наук, Москва)

кандидат биологических наук,

Захарова Марина Викторовна

(старший

научный

сотрудник

лаборатории

молекулярной

микробиологии

Федерального

государственного

бюджетного

учреждения

науки

Института биохимии и физиологии микроорганизмов

им. Г.К. Скрябина Российской академии наук, Пущино)

Федеральное государственное бюджетное учреждение

науки Институт Молекулярной Биологии им. В.А.

Энгельгардта Российской академии наук

Работа выполнена в лаборатории функциональной геномики и клеточного стресса

Федерального государственного бюджетного учреждения науки Института биофизики клетки

Российской академии наук.

Защита диссертации состоится «07» апреля 2016 года в «14» часов 00 мин.

на

заседании

диссертационного

совета

Д.002.038.01 Федерального

государственного

бюджетного учреждения науки Института биофизики клетки Российской академии наук по

адресу: 142290 г. Пущино Московской области, Институтская ул. 3.

С диссертацией можно ознакомиться в Центральной библиотеке ПНЦ РАН по адресу:. 142290

г. Пущино Московской области, Институтская ул. 3.

Автореферат разослан «____»______________2016 г.

Ученый секретарь

диссертационного совета,

Смолихина

кандидат биологических наук

Татьяна Ивановна

- 2 -

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы

Белок Dps играет важнейшую роль в адаптации бактериальных клеток к

различным стрессам, в том числе к аминокислотному голоданию при переходе

бактерий к стационарному росту. Его уникальной особенностью является

сочетание

двух

трудно

совместимых

функциональных

активностей:

ферментативное

окисление

двухвалентного

железа

с

разложением

гидропероксида и компактизация бактериальной хромосомы, для которой опасно

соседство с активными формами кислорода [Almiron et al., 1992; Zhao et al.,

2002]. Свойства самого белка интенсивно изучались на протяжении последних

десятилетий, однако регуляция экспрессии его гена, по-прежнему, остается не до

конца понятной.

Известно, что транскрипция гена dps запускается под действием широкого

спектра химических и физических факторов, однако имеющиеся данные о

механизмах активации не могут объяснить большую часть регистрируемых

изменений. До начала этой работы в регуляторной области гена dps был

картирован

один

промотор,

распознаваемый

двумя

разными

сигма-

субъединицами РНК-полимеразы. Вблизи него расположены сайты для

взаимодействия с 5 регуляторными белками, два из которых стимулируют

транскрипцию в ответ на окислительный стресс и при переходе к стационарному

росту, а три являются репрессорами и блокируют транскрипцию во время

быстрого роста клеток [Salgado et al., 2013]. Однако внутри регуляторной

области гена dps компьютерный алгоритм PlatProm предсказал ещё 4 промотор-

подобных сайта, удалёных от ATG кодона и способных модулировать

экспрессию гена dps в ответ на изменение внешних факторов. Задачей

исследования было изучение их функциональных свойств, роли в регуляции

транскрипции гена dps и поиск регуляторных белков, способных влиять на

активность

дополнительных

промоторов.

Актуальность

исследования

обусловлена

фундаментальной

значимостью

понимания

особенностей

экспрессии

генов,

контролируемых

множественными

промоторами

и

уникальным сочетанием функциональных свойств у белка Dps.

Цель и задачи исследования

Основной целью данной работы было изучение особенностей регуляции гена

dps в клетках Escherichia coli (E.coli).

Конкретными задачами были:

1.

Исследование структурно-функциональной организации промоторной

области гена dps.

2.

Оценка возможности участия белка Dps в регуляции гена dps.

3.

Поиск новых регуляторов экспрессии гена dps.

Научная новизна работы

Впервые

установлено,

что

в

регуляторной

области

гена

dps

есть

дополнительные промоторы, способные взаимодействовать с РНК-полимеразой

и инициировать синтез РНК. Несмотря на низкую активность, они необходимы

для максимальной экспрессии гена, причём вклад дополнительного промотора P3

- 3 -

В регуляторной области гена dps впервые обнаружены потенциальные сайты

связывания для 11 новых факторов транскрипции. Взаимодействие с нею

впервые зарегистрировано для двух регуляторов клеточного метаболизма -

глобального CRP и специфического ExuR. Так как ген dps кодирует структурный

белок нуклеоида с ферментативной ферроксидазной активностью, зависимость

его экспрессии от метаболических регуляторов не является тривиальной.

Потенциальные сайты связывания CRP и картированные сайты связывания ExuR

находятся вблизи дополнительных промоторов. Филогенетический анализ этой

области предполагает её появление в геноме E. coli в результате горизонтального

переноса. Поэтому функциональная организация промоторной области гена dps

может быть результатом адаптивной ассимиляции чужеродного генетического

материала, которая предоставила кишечной палочке возможность оперативного

сопряжения метаболический статус клетки со структурным состоянием генома.

Научно-практическое значение работы

Ключевая роль Dps в упаковке бактериальной хромосомы и защите генома от

повреждающих факторов предполагает зависимость экспрессии его гена от

малейших изменений в режиме роста. В работе впервые было показано, что эта

зависимость в значительной степени опосредована дополнительным промотором

Р3, который вносит существенный вклад в модуляцию транскрипции гена в

стрессовых условиях. В процессе выполнения работы было создано несколько

промоторных конструкций, которые в сочетании с геном репортёрного белка

GFP позволяют детектировать минимальные изменения в условиях роста, что

делает возможным их использование в качестве биосенсоров. Информация о

белках, регулирующих транскрипцию гена dps в зависимости от скорости роста,

делает возможным управляемое снижение его экспрессии. Замедляя переход

клеток к стационарному росту, т.е. увеличивая время продуктивного биосинтеза,

это может оказаться полезным для промышленной биотехнологии. Т.к.

обнаруженные

в

работе

дополнительные

промоторы

необходимы

для

максимальной экспрессии гена dps, их введение в промышленные вектора может

улучшить систему для суперпродукции рекомбинантных белков в клетках E.coli

под контролем промотора Pdps, предложенную в работе [Sethia et al., 2014].

Апробация работы

Результаты работы были представлены на XXII зимней школе-конференции

молодых ученых «Перспективные направления Физико-химической биологии и

биотехнологии» (Москва, 2010), 14 и 18 Пущинских международных школах-

конференциях молодых ученых «Биология наука XXI века» (Пущино, 2010 и

2014 г.),

2ом Международном форуме по биотехнологии “EurasiaBio-2010”

- 4 -

Впервые показано, что

промоторами своего гена и

активатора или репрессора.

белок Dps способен селективно связываться с

участвовать в регуляции его экспрессии, играя роль

оказался непропорционален его собственной транскрипционной активности. Это

предполагает возможность функционирования РНК-полимеразы на некоторых

промоторах не только в качестве фермента транскрипции, но и в качестве

регуляторного белка, влияющего на экспрессию соседних промоторов.

(Москва, 2010), съезде EMBO (Барселона, 2010), 2ом международном семинаре

по биологии и физике бактериальной хромосомы (Бирмингем, 2014), а также на

6-ом конгрессе FEMS (Маастрихт, 2015). Работа также докладывалась на

внутренних семинарах лаборатории функциональной геномики и клеточного

стресса ИБК РАН. По материалам диссертации было опубликовано 5 печатных

работ в рецензируемых журналах, рекомендуемых ВАК.

Публикации

По материалам диссертации опубликовано 13 печатных работ, в том числе, 5

статей в реферируемых журналах и 1 статья в сборнике.

Структура и объём диссертации

Диссертационная работа состоит из введения, обзора литературы, материалов

и методов, результатов и их обсуждения, заключения, выводов и списка

цитируемой литературы, включающего 271 источник. Работа изложена на 117

страницах машинописного текста и содержит 37 рисунков и 3 таблицы.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Компьютерные

программы

и

алгоритмы.

Последовательности

регуляторной области гена dps были взяты из базы данных MicrobesOnline [Dehal

et al., 2010]. Их выравнивали с помощью алгоритма Pro-Coffee [tcoffee.crg.cat,

Notredame et al., 2000]. Поиск потенциальных сайтов связывания для факторов

транскрипции

осуществляли

с

помощью

программы

Virtual

Footprint

[http://www.prodoric.de/vfp/, Münch et al., 2005], учитывая информацию базы

данных Regulon DB [ http://regulondb.ccg.unam.mx/, Salgado et al., 2013]. Для

поиска потенциальных промоторов использовали алгоритм PlatProm [Shavkunov

et al., 2009]. Подбор праймеров для обратной транскрипции и амплификации был

осуществлен с учетом их уникальности в геноме E. coli (программа DNA_tools,

автор А.Деев ИТЭБ РАН), GC-состава и стабильности вторичных структур

(RNA-structure 4.3, http://rna.chem.rochester.edu ). Праймеры для ПЦР в реальном

времени

были

подобраны

с

помощью

программы

Primer

3

(http://frodo.wi.mit.edu/primer3/).

Бактериальные штаммы и условия культивирования. Для выделения

нуклеиновых кислот был использован стандартный штамм Escherichia coli K 12

(GenBank accession number: U00096.2). Клетки выращивали до OD600=0.4

(экспоненциальная фаза) или 0.9 (стационарная фаза) при 37°С и постоянном

перемешивании на среде LB. Для исследования экспрессии dps в условиях

холодового и теплового шока клетки растили при 37°С до OD600 = 0.6, быстро

охлаждали до 25°C или нагревали до 42°C и выдерживали 1-3 часа при

постоянном перемешивании [Bae et al., 2000, Barlett 1994]. Флуоресценцию

рекомбинантного GFP измеряли на микроскопе Leica (объектив Carl Zeiss 2.5x) в

колониях клеток E. coli Тор 10 (Invitrogen, США), выращенных на стандартной

среде LB Plates с добавлением канамицина (20 мкг/мл). Суперпродукцию белков

Dps и CRP проводили в клетках E.coli BL21 (DE3), трансформированных

плазмидами pGEM_dps или pET28b_CRP со встроенными под контроль

- 5 -

промотора T7 генами соответствующих белков. Клетки растили в среде LB с

добавлением ампицилина (100 мкг/мл) или канамицина (40 мкг/мл) при 37°С до

OD600 = 0.6, затем добавляли 0.02, 0.1 или 1 мМ IPTG и продолжали культивацию

при 37°С и постоянном перемешивании ещё 4-8 часов. Для измерения

активности β-галактозидазы использовали клетки E.coli M182. Их растили на

минимальной среде M9 с добавлением 0.2% глюкозы, 5% LB и тетрациклина (35

мкг/мл) до экспоненциальной фазы. Аналогичные условия роста были

использованы и для метода «DNA-sampling» [Butala et al., 2009]. В этом случае

был использован штамм E.coli K12 MG1655 lacI:FLAG, клетки, которого были

трансформированы

плазмидами

pACBSR-DL1

и

pRW902,

несущей

регуляторную область гена dps. Клетки растили в среде М9 [Butala et al., 2009] с

добавлением хлорамфеникола (25 мкг/мл) и тетрациклина (35 мкг/мл) при 37°С

до OD600=0.6. Экспрессию гена мегануклеазы в pACBSR-DL1 индуцировали

0.2% арабинозой с последующей инкубацией в течение 20 минут.

Оценка способности фрагментов ДНК взаимодействовать с σ70-РНК-

полимеразой или с белками Dps и CRP E.coli. Эффективность взаимодействия

промотор-содержащих фрагментов ДНК с исследуемыми белками оценивали с

помощью метода задержки в геле (gel-mobility shift assay). Пробы, содержащие

1х транскрипционный буфер (5 мМ Tris-HCl (pH 8.0), 1 мМ MgCl2, 0.01 мМ

EDTA, 25 мкг/мл BSA, 5 мМ NaCl) и

~1 пмоль ДНК, предварительно

уравновешивали при 37ºС в течение 20 минут, после чего в опытные образцы

добавляли 1-, 2- или 4- пмоль σ70-РНК-полимеразы (Sigma, США) и

инкубировали при той же температуре еще 20 минут для формирования

комплексов. Для разрушения неспецифических контактов в пробы добавляли

гепарин (20 мкг/мл) и наносили образцы на прогретый до 37ºС 4% ПААГ.

Аналогичным образом проводили оценку взаимодействия очищенного белка Dps

с фрагментами регуляторной области гена dps в молярных соотношениях 1:2, 1:5

и 1:10. Суперпродукцию и очистку рекомбинантного белка Dps проводили как

описано в [Покусаева и др. 2012]. Кроме этого для оценки взаимодействия с

фрагментами регуляторной области гена dps методом задержки в геле были

использованы клеточные лизаты с суперпродуцированными белками Dps и

cAMP-СRP. Эксперименты были выполнены аналогично описанным выше со

следующими модификациями: концентрация белка в лизате была измерена на

спектрофотометре NanoDrop 1000 (NanoDrop Technologies Inc., США), на одну

пробу, содержащую 1 пмоль ДНК, было взято 0.03-0.12 мкг белка, комплексы

формировались при комнатной температуре в течение 30 минут. После

формирования

комплексов

в

пробы

добавляли

глицерин

до

конечной

концентрации 10% и наносили на 4% полиакриламидный гель.

Локализация сайтов взаимодействия РНК полимеразы и белка Dps. Для

локализации мест связывания белков с промоторной ДНК использовали метод

футпринтинга ДНКазой I. Проба содержала 1 пмоль [γ-32P] промотор-содержащего

фрагмента ДНК, 1х-транскрипционный буфер, 1-4 пмоль РНК-полимеразы (Sigma,

США) или 1-10 пмоль очищенного белка Dps. После инкубации (37ºС, 30 мин) к

пробам добавляли панкреатическую ДНКазу I до концентрации 1 мкг/мл,

выдерживали 25 секунд и останавливали реакцию равным объемом 8 М ацетата

аммония. Продукты гидролиза осаждали 2.5V этанола, промывали 70% этанолом,

- 6 -

высушивали, растворяли в 5 мкл формамидного буфера и анализировали в 8%

денатурирующем полиакриламидном геле. Футпринтинг сайтов взаимодействия с

РНК полимеразой перманганатом калия проводили по протоколу, предложенному

[Zaychikov et al 1997]. Гели калибровали с помощью продуктов гуанин-

специфичного секвенирования соответствующих фрагментов ДНК по Максаму-

Джилберту [Maniatis 1982, Maxam 1985] и стандартных наборов фрагментов ДНК

(Fermentas), меченных [γ-32P] АТР.

Реакция удлинения праймера in vivo. Тотальную клеточную РНК

выделяли как описано в [Favre-Bonte 1999] Смесь РНК (20 мкг) с

P-меченным

праймером (4 пмоль) выдерживали в течение 10 минут при 70ºС, добавляли 8 мкл

смеси, содержащей 5x реакционного буфера (Fermentas, 250 мМ Tris-HCl, pH 8.3,

250 мМ KCl, 20 мМ MgCl2 и 50 мМ DTT), dNTP до конечной концентрации 0.2мМ,

и охлаждали на льду для предотвращения ренатурации образцов. После этого

добавляли 20 U обратной транскриптазы M-MuLV (Fermentas, Литва) и

синтезировали кДНК при 42°C в течение 40 минут. Для инактивации фермента

смесь прогревали 5 минут при 85°C. Затем пробы обрабатывали РНКазой А (10 U,

37°C, 30 минут), осаждали, растворяли в 5 мкл формамидного буфера и наносили

на 8% ПААГ с 8М мочевиной.

Количественная ПЦР в реальном времени. кДНК получали в

соответствии с протоколом фирмы-производителя (Fermentas, Литва). Реакцию

проводили

на

амплификаторе

ДТ-322

(ДНК-Технология,

Россия)

с

использованием интеркалирующего флуоресцентного красителя SYBR Green I

(Sigma, США). Реакционная смесь (20мкл) содержала 2-4 мкл кДНК, по 4 пмоль

каждого праймера, 0.1 мМ каждого dNTP, стандартный буфер (Евроген, Россия),

1 мкл SYBR Green I (разведение 1:3000) и 1 U Taq-полимеразы (Евроген,

Россия). Программа амплификации для всех пар праймеров была следующей:

предварительная денатурация при 94°C, 2 мин; далее 30 циклов: 94°C - 30 сек,

54°C - 30 сек, 72°C - 35 сек. Флуоресцентный сигнал регистрировали в конце

каждого цикла в течение 15 секунд. В качестве позитивного контроля

использовали пробы, содержащие геномную ДНК E. coli, а в качестве

негативного – пробы с РНК, проведенные через реакцию обратной транскрипции

без

добавления

фермента.

Качество

ПЦР-продуктов

оценивали

электрофоретически в 5%-ом ПААГ (210В, 100мА). Количественный анализ

проводили при помощи программы q_PCR (ДНК-Технология). Относительное

количество синтезированных ампликонов рассчитывали по формуле 2ΔCt.

Эксперименты «Pull down» Очищенные фрагменты ДНК (80 пикомоль),

были сшиты по 3’ концу с биотином согласно протоколу (Sileks, Россия). После

чего их инкубировали 15 мин при комнатной температуре с 0.24 мг магнитных

частиц, покрытых стрептавидином (NEB, США), в буфере для связывания ДНК,

содержащем 0.5 М NaCl, 20 мМ Tri-HCl pH 7.5, 1 мМ EDTA. Несвязанные

фрагменты ДНК удаляли и дважды промывали магнитные частицы буфером для

связывания ДНК. Пробы инкубировали 4-8 часов на вращающейся платформе

при 4°C с клеточным лизатом в буфере, содержащем 10 мМ HEPES-KOH pH 8.0,

0.25 мМ EDTA, 1 мМ PMSF, 20% глицерина, 0.3 % NP-40, 150 мМ KCl, 1.5 мМ

MgCl2. Несвязанную фракцию белков удаляли после осаждения частиц на

магнитном штативе, а пробы промывали 4 раза по 200 мкл таким же буфером, но

- 7 -

32

с 250 мМ KCl. Белки, ассоциированные с исследуемыми фрагментами ДНК,

смывали с магнитных частиц кипячением в формамидном буфере и наносили на

денатурирующий SDS-ПААГ. После электрофоретического фракционирования

полоски с геля вырезали и масс-спекрометрически (НИИ физико-химической

медицины, Москва) определяли содержащиеся в них белки.

DNA-sampling проводили как описано в [Butala et al., 2009]. Специфически

связанные белки смывали с шариков буфером, содержащим 0.1 M NaHCO3, и

идентифицировали с помощью LCMS (Liquid chromatography–mass spectrometry)

спектрометрии в CRG/UPF Proteomics Unit (Барселона, Испания). Контролем

служили магнитные частицы, проикубированные с клеточным лизатом штамма

E. coli K12 MG1655 lacI-FLAG, не содержащего плазмид.

Вестерн-блот. Белки после электрофоретического разделения в ПААГ

были перенесены на поливилиденфторидную (PVDF) мембрану с помощью

«мокрого» переноса в блот-буфере, содержащем 47.9 мМ Tris-HCl pH8.0, 38.6

мМ глицина, 0.0385% SDS и 20% этанола, при 100В в течение 60 минут. Для

блокировки неспецифического связывания мембрану выдерживали в 0.5%

растворе сухого молока (Oxoid, Великобритания), разведенного в 10 мМ Tris-HCl

pH 8.0, 0.14M NaCl. Затем мембрану инкубировали со специфическими

поликлональными антителами кролика к белкам Dps (1:1000) или CRP (1:500,

Cell Signalling, США) в аналогичном буфере, но с добавлением 1:1000 (V:V)

Tween-20 (1 час, 37°С). Антитела к белку Dps были получены в лаборатории

культур клеток и клеточной инженерии ИБК РАН. Затем несвязанные антитела

отмывали,

добавляли

антитела

к

кроличьему

иммуноглобулину,

конъюгированному щелочной фосфатазой и инкубировали еще 60 минут. Для

окраски белков добавляли субстрат щелочной фосфатазы 5-бромо-4-хлоро-3-

индозил-фосфата (Western Blue, Promega, США).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ.

1. Исследование структурно-функциональной организации регуляторной

области гена dps

Алгоритмом PlatProm в межгенной области rhtA-dps помимо основного

промотора Pdps, имеющего стартовую точку транскрипции в позиции -39 от ATG-

кодона (Рис. 1), было обнаружено 4 дополнительных промотор-подобных сайтов с

точками старта в позициях -85, -116, -196 и -261 от ATG-кодона (P1, P1’, P2 и P3) и 4

потенциальных промотора антисмысловго направления Pа1, Pа2, Pа3 и Pa4.

В результате множественного выравнивания регуляторных областей гена dps,

взятых из геномов близкородственных E. coli бактерий, оказалось, что

промоторы Pdps и Р1 есть в геномах всех исследованных микроорганизмов (46

штаммов E. coli, 6 штаммов шигелл, E. albertii, C. rodentium, S. enterica, En.

Lignolyticus). Но область, удаленная от ATG кодона более чем на 130 п.н.,

отсутствует у ближайших родственников E. coli –шигелл, но есть у E. albertii и

C. rodentium. Следовательно, она могла быть получена кишечной палочкой в

результате горизонтального переноса, хотя значимой гомологии в геномах

известных на данный момент бактерий обнаружить не удалось. Перенесённый

фрагмент высоко консервативен в геномах E. coli, что указывает на вероятное

- 8 -

участие дополнительных промоторов P2 и P3 в регуляции экспрессии гена dps.

Целью экспериментальной работы стала проверка этого предположения.

Рис. 1 Распределение промотор-подобных сигналов в межгенной области rhtA-dps. Значения

показателей промотор-подобия (веса), рассчитанные PlatProm (p 0,00004), отложены по оси ординат.

Значения, отложенные выше оси абсцисс, соответствуют синтезу РНК в сторону гена (dps), а значения,

отложенные ниже оси, соответствуют промоторам антисмыслового направления. Кодирующие области

генов обозначены серыми стрелками, праймеры – черными стрелками (5'→ 3'),. зеленые и красные

прямоугольники показывают сайты связывания активаторов и репрессоров транскрипции гена dps.

2. Оценка функциональной активности предсказанных промоторов in

vitro и in vivo

Методом задержки в геле (Рис. 2А) установлено, что два линейных

фрагмента, включающих всю межгенную область rhtA-dps (праймеры 3 и 2, Рис.

1) и ее укороченный вариант (праймеры 1 и 2) формируют множественные

комплексы с σ70-РНК-полимеразой (РНКП). При добавлении P3 и Pa4 на левый

конец фрагмента мы наблюдали появление дополнительного комплекса с более

высокой подвижностью (Рис 2А), что указывает на возможность независимого

взаимодействия с ними РНКП, в то время, как проксимальные промоторы, по-

видимому, могут формировать олигомеры, содержащие несколько молекул

полимеразы. Так как четырёхкратный избыток фермента воспроизводимо

увеличивал, а не уменьшал количество свободной ДНК, не исключена

возможность кооперативного взаимодействия РНКП с промоторами ближней

области. В любом случае РНКП взаимодействует с промоторной областью гена

dps и формирует с ней, по крайней мере, 5 разных комплексов.

Транскрипционная активность промоторов Р3-Р1 была исследована в

системе репортерной детекции с использованием плазмиды pET28b-eGFP,

содержащей ген зелёного флуоресцирующего белка. Флуоресценция колоний

клеток, трансформированных плазмидами с геном gfp под контролем Pdps

совместно с P2, P1' и P1 превышала контрольный уровень в 6 раз (нижняя средняя

панель Рис. 2Б). Это свидетельствует о высокой промоторной активности

вставки, но при добавлении к его upstream-области промотора P3 происходило

усиление транскрипции gfp, и уровень флуоресценции белка превышал

контрольный уже в 9 раз. При этом промоторы Р3 и Р2 сами по себе не были

- 9 -

способны

транскрибировать

gfp-мРНК

(верхний

ряд

Рис.

2Б).

Рис. 2 А: Электрофорез с задержкой в геле комплексов, формируемых промоторами гена dps с σ70-

РНКП. Молярное соотношение фермента к ДНК указано над дорожками. Праймеры, использованные

для амплификации фрагментов, указаны внизу геля. Стрелкой отмечен комплекс, появляющийся

только при наличии Р3 и Ра4 Б: Флуоресценция колоний клеток, несущих плазмиды pET28b-EGFP с

делетированным промотором перед геном gfp (контроль) или плазмиду, содержащую промоторы

регуляторной области гена dps в указанных комбинациях (указаны над фотографиями).

Следовательно, P3, будучи малоактивным сам по себе, существенно влиял на

суммарную транскрипцию гена, активируя либо один из дополнительных промоторов, либо

Pdps. О низкой активности дополнительных промоторов в плазмиде свидетельствуют и

результаты обратной транскрипции с праймером GFP3 из кодирующей области гена gfp, и

футпринтинга перманганатом калия in vitro (Рис. 3).

Рис. 3 Оценка транскрипционной активности промоторов регуляторной области гена dps с помощью обратной

транскрипции с плазмиды pET28b_eGFP (дорожка 2) или с генома (дорожки 7 и 8), а также футпринтинг

комплексов с РНКП перманганатом калия (дорожки 3-5). Молярное соотношение РНКП:ДНК указано над

дорожками. В качестве матрицы для обратной транскрипции была использована тотальная РНК, выделенная из

клеток E. coli K12 MG1655 (дорожки 7 и 8, праймер 5) или РНК, синтезированные с промоторов Р3-Р2-Р1’-P1-Pdps,

встроенных в pET28b-eGFP (Рис. 2Б) и внутригенный праймер gfp. Для футпринтинга был использован фрагмент

геномной ДНК, амплифицированный с праймерами 3 и 5. Калибровка гелей выполнена с помощью G-

специфического секвенирования по Максаму и Гилберту [Маниатис, 1984]. Позиционные координаты указаны

относительно ATG-кодона dps.

- 10 -

В реакции обратной транскрипции с праймера, расположенного внутри

гена gfp, был получен только продукт Pdps (Рис. 3, дорожка 2), а футпринтинг

пермаганатом калия выявил локально расплетенные участки только для Pdps, P1 и

P1’ (дорожки 3-5). Активность промоторов Р2 и Р3 была впервые зарегистрирована

в реакции обратной транскрипции с хромосомной ДНК (Рис. 3, дорожки 7 и 8).

Используя реакцию однократной инициации транскрипции с разными по

длине матрицами (Рис. 4) мы обнаружили, что основной продукт в смысловом

направлении синтезируется с промотора Pdps, что хорошо согласуется с данными

Рис. 3. Кроме этого, с праймерами 1+5 и 3+5 были зарегистрированы более

слабые продукты, размер которых позволяет говорить об инициации синтеза на

дополнительных промоторах. Так, продукт, соответствующий по размеру РНК,

синтезированной с Р3, (354 и 252 н., соответственно) виден на дорожках 3+5 и

3+2, а на матрицах 3+5 и 1+5 видна РНК с Р2 - 289 н. Её больше синтезируется с

матрицы 3-5, возможно потому, что праймер 1 затрагивает его UP-элемент.

Рис.

4

Продукты

реакции

однократной

инициации

транскрипции

с

σ70-РНКП,

присутствующей в пробах в 8-кратном избытке

по

отношению

к

матрице.

Праймеры,

использованные для амплификации матрицы,

указаны над гелем. Расположение праймеров см.

на Рис. 1. Стрелками слева указаны продукты,

соответствующие предсказанным промоторам.

Размер ожидаемых продуктов с Р1’ составляет 209 и 107 н. Они хорошо

видны на геле. Расчётная длина продуктов, синтезируемых с Р1 на матрицах 1+5

и 3+5 =178 н. Такого размера РНК видна только на матрице 1-5. Его отсутствие

на дорожке 3-5 может быть обусловлено нехваткой РНКП в условиях

конкуренции с бóльшим числом промоторов. РНК с промоторов Ра4, Pa3 и Pa2

могут быть обнаружены только на матрицах 3+2 и 3+5, но из трёх ожидаемых

продуктов (длины 95-98 и 199-212 н. и 226-241 н.), мы увидели синтез РНК

только с двух стартовых точек промоторного кластера Pa3. Активность

промотора Ра1 могла быть зарегистрирована только на матрицах 3+5 и 1+5, и

продукты ожидаемой длины (421 и 262 н.), действительно наблюдаются. Кроме

этого в эксперименте с однократной инициацией транскрипции зарегистрирован

продукт антисмысловой реакции

длиной ~270-280 н. (Рх), промотор для

- 11 -

которого предсказан PlatProm с относительно низкой достоверностью (вес = 4,62,

p0,001).

Таким образом, футпринтинг перманганатом калия (Рис. 3) и тестирование

продуктов однократной инициации транскрипции in vitro (Рис. 4) свидетельствуют

о безусловном доминировании промотора Pdps, но допускают способность всех

четырёх дополнительных промоторов вести независимый синтез РНК. На

следующем этапе относительная эффективность синтеза РНК с основного и

дополнительных смысловых промоторов была проверена с помощью обратной

транскрипции с последующим ПЦР в реальном времени (qRT-PCR). В качестве

контроля была взята РНК, синтезируемая с антисмыслового промотора Pa1,

активность которого в условиях in vitro была сопоставима с P3 (Рис. 5).

Рис. 5 Относительная эффективность транскрипции с промоторов гена dps. За единицу был взят

уровень экспрессии антисмыслового продукта, синтезируемого с Pa1 (праймеры 7 и 2, обратная

транскрипция с праймера 7, длина продукта 73 н., Рис. 1). Продукт, отражающий активность всех

смысловых промоторов (Р3-P2-P1’-P1-Pdps) был получен с праймерами 6 и 5 (длина продукта – 130 п.н.), а

дополнительных промоторов Р3-P2-P1’-P1– с праймерами 7 и 5). Для индивидуального тестирования Р3

использовали праймеры 1* и 8 (длина продукта – 126 п.н.). Эксперименты проведены в трех

биологических и двух технических повторностях.

Как и ожидалось, уровень мРНК, синтезируемых с дополнительных

промоторов, даже суммарно оказался намного ниже, чем с основного, и Р3 был

самым слабым. Это могло быть следствием неспособности Р3 конкурировать с

находящимся рядом сильным промотором за связывание с РНКП. Поэтому мы

использовали мутантную регуляторную область гена dps в составе вектора

pET28b-eGFP, полученную с помощью массированного PCR-мутагенеза с

отбором неактивных производных (процедура SELEX). Наколенные мутации

снизили соответствие консенсусу у элементов -10 промоторов Pdps, и Р1’, но

повысили его у элемента -10 промотора P3. Футпринтинг перманганатом калия

показал, что спонтанные мутации блокировали взаимодействие полимеразы с Pdps

(дорожки 1 и 2 Рис.6). При этом было зарегистрировано образование более

мощного открытого комплекса в промоторной области P2/Pa2, что, по-видимому,

объясняется

отсутствием

конкуренции

за

РНКП

со

стороны

Pdps.

P2,

следовательно, может быть «запасным» промотором, обеспечивающим базовый

уровень транскрипции гена dps в случае блокировки его основного промотора.

Перманганатный футпринтинг для фрагмента ДНК, содержащего промотор P3,

выявил образование открытого комплекса с РНКП, как для хромосомного

(дорожка 11), так и для плазмидного (дорожка 12) фрагмента ДНК. При этом

- 12 -

мутация в консервативном элементе -10 Р3 не увеличила его эффективность

связывания с σ70-РНКП, и модификации подвергся только один из трёх

потенциально доступных тиминов. Возможно, это означает, что РНКП

формирует с Р3 особые по структуре комплексы.

Рис. 6 Футпринтинг перманганатом калия комплексов Pdps, P2/Pa2 и P3 с РНКП, сформированных в

соотношении РНКП:ДНК 4:1 с фрагментами, амплифицированными с геномной (дорожки «1») или

плазмидной ДНК, содержащей мутантный промотор (дорожки «2»). Положение неспаренных тиминов

показано стрелками. Дорожки M и G соответствуют маркерам молекулярного веса и сиквенсу

исследуемого фрагмента по G. Продукты ожидаемых размеров с Pdps, P2/Pa2 и P3, указаны стрелками.

Таким образом, в регуляторной области гена dps, помимо Pdps, есть

дополнительные промоторы для смысловой и антисмысловой транскрипции,

которые имеют низкую транскрипционную активность, но вносят существенный

вклад в активацию основного промотора. Поэтому целью наших дальнейших

исследований было детальное изучение транскрипции гена dps в различных

условиях и возможного вклада обнаруженных промоторов в ее регуляцию.

3. Влияние дополнительных промоторов на экспрессию гена dps в

стрессовых условиях

Ранее нами было показано, что облучение клеток E. coli электромагнитным

полем низкой интенсивности стимулирует экспрессию гена dps, т.е. должно

влиять на активность его промоторов [Антипов и др., 2007]. Для оценки вклада

новых промоторов в эту активацию, были использованы плазмиды с геном gfp,

поставленным под контроль всей регуляторной области гена, или ее фрагмента

без промотора Р3 (Рис. 7А). ЭМИ СВЧ, действительно, стимулировало синтез

зелёного белка, и этот эффект был более выражен при наличии Р3, что указывает

- 13 -

электромагнитного

поля и

на его регуляторную роль в этом ответе. При этом ЭМИ не влияло на биосинтез

GFP, если в плазмиду был интегрирован промотор гена hns, который кодирует

другой белок нуклеоида (Рис. 7Б). Это свидетельствуют о специфическом

изменении экспрессии гена dps в ответ на облучение ЭМИ СВЧ и о возможной

регуляторной роли Р3 в этом процессе [Швырева и др., 2011]. Не исключено

также, что белок Dps, имеющий ферритовый кластер в своей полости, может

Рис. 7 Накопление репортерного белка GFP в клетках E. coli Top10 под действием ЭМИ СВЧ после 2-х

часовой экспозиции. Клеточные лизаты были фракционированы с помощью нативного электрофореза в

ПААГ. Флуоресценцию регистрировали на УФ-трансиллюминаторе. Количество белка в нанесенных

пробах оценивали по окрашиванию этих же гелей Кумасси R-250.

Dps

-

единственный

белок

кишечной

палочки,

способный

взаимодействовать с ДНК, изменяя архитектуру бактериальной хромосомы, и

окислять двухвалентное железо, накапливая его оксиды внутри своей полости в

форме ферригидритных кластеров. Окисление ионов железа сопряжено с

утилизацией пероксида водорода. То есть, Dps принимает активное участие в

преодолении клетками окислительного стресса. За активацию его биосинтеза в

условиях оксидативного стресса отвечает регуляторный белок OxyR, который

имеет два сайта связывания в промоторной области dps с центром в позициях -44

и -66 [Almiron et al., 1992] от стартовой точки Pdps, т.е. вблизи промоторов P1 и

P1’ (Рис. 1). В системе репортерной детекции, транскрипционная активность трёх

антисмысловых промоторов (конструкция Pa1 + Pa2 + Pa1) оказалась на уровне Р3

и, так же, как Р3 не проявляла зависимости от присутствия пероксида водорода

(Рис. 8). В отличие от этого, оба промоторных кластера, содержащие всю

промоторную область (P3- Pdps) или промоторы P2 + P1’ + P1 + Pdps (P2-Pdps),

продемонстрировали явную активацию транскрипции при добавлении 1 мМ

Н2О2. При этом, присутствие P3 неаддитивно увеличивало общую активность

промоторов, особенно в стрессовых условиях. Т.е. не реагируя на присутствие

пероксида сам по себе, Р3 заметно стимулировал адаптивный ответ всей

регуляторной области. Поэтому на следующем этапе была исследована

зависимость активности разных промоторов от теплового и холодового шоков.

- 14 -

играть роль эндогенного сенсора вариаций

посредника в адаптации клеток к этим вариациям.

Рис. 8 Зависимость флуоресценции GFP, синтезируемого в клетках E coli K12 MG1655 под контролем

промоторов регуляторной области гена dps, в ответ на окислительный стресс. Эксперименты

проведены в трех биологических и двух технических повторностях.

Оказалось, что активность полного набора промоторов всегда выше, чем

конструкции Р2-Рdps. Резкое снижение температуры с 37°С до 30°С подавляло

активность Р2-Pdps, практически не изменяя синтез РНК с Р3-Pdps. Но при более

значительном понижении температуры (до 23°С), а также при переносе клеток в

42°С, когда транскрипционная активность всех промоторных конструкций

падала, присутствие Р3 усиливало адаптивные изменения. Это указывает на

очевидную роль Р3 в регуляции экспрессии гена dps, поэтому дальнейшей

задачей исследования стал поиск в его последовательности возможных

регуляторных сигналов и сайтов связывания регуляторных белков. А так как

большая часть генов, кодирующих регуляторы транскрипции, подвержены

авторегуляции,

то

первоочередной

задачей

стала

оценка

возможности

связывания белка Dps с собственной регуляторной областью.

4. Исследование возможности участия белка Dps в регуляции экспрессии

гена dps

На данный момент механизм связывания Dps с ДНК до конца не понятен.

В структуре Dps нет классического модуля для взаимодействия с ДНК, но есть

основания полагать, что он связывается с ДНК, распознавая в ней разветвлённые

или

локально-денатурированные

структуры

[Melekhov

et

al.,

2015].

В

регуляторной области гена dps есть идеальный инвертированный повтор

(TTCTGCATGGTTATGCATAACCATGCAGAA), способный к формированию

шпилечной структуры. Поэтому для проверки гипотезы о возможном прямом

влиянии Dps на экспрессию собственного гена, мы получили делеционный

мутант штамма E. coli K12 MG1655 по гену dps, как описано в работе [Datsenko,

Wanner, 2000]. Для проверки правильности делеции и отсутствия нежелательных

вставок, мутантный штамм был подвергнут полногеномному секвенированию на

платформе Illumina (MiSeq). Колонии клеток исходного и мутантного штамма,

трансформированные

беспромоторной

плазмидой

pET28b-eGFP,

имели

одинаковый уровень флуоресценции (Рис. 9, правые панели). Промоторные

вставки Р2-Рdps и Р3-Рdps активировали экспрессию gfp в клетках исходного шамма

в 26 и в 38 раз, соответственно, но в клетках делеционного мутанта всего в 11-13

раз. Это снижение уровня флуоресценции GFP в мутантных по гену dps клетках

по сравнению с колониями клеток дикого типа вполне может быть обусловлено

непосредственным участием Dps в стимуляции транскрипции dps (Рис. 9).

- 15 -

Рис. 9 Флуоресценция колоний клеток дикого типа E. coli K12 MG1655 (верхний ряд) и E. coli K12

MG1655∆dps (нижний ряд), несущих плазмиду pET28b_eGFP с делетированным промотором перед

геном gfp (контроль), плазмиду, содержащую всю промоторную область (Р3-Рdps) или промоторный

кластер Р2-Рdps, без Р3 (указано). Из-за большой разницы в интенсивности свечения колоний, их

фотографировали при разной экспозиции (указано). Цифрами указана интенсивность свечения,

пересчитанная на 1 секунду экспозиции.

Важным результатом этого эксперимента является отсутствие активации

экспрессии gfp в мутантном штамме при добавлении промотора P3 (сравн. панели

Р2-Рdps P3-Pdps в нижнем ряду Рис. 9). Косвенно это указывает на то, что

стимулирующее действие Dps опосредовано взаимодействием с областью,

включающей промотор Р3. Подтвердив эту закономерность qRT-PCR, мы

сравнили активность разных промоторов в клетках исходного и мутантного

штаммов в ответ на оксидативный и температурный стрессы. Оказалось, что ответ

клеток на оксидативный стресс практически не зависит от делеции dps.

При тепловом шоке (Рис. 10А) в течение первых 30 минут в мутантном

штамме (синий столбик) наблюдается небольшая активация промоторов Р2-Рdps

по сравнению с диким типом (голубой столбик). Это указывает на слабое

самоингибирование гена в ответ на температурный стресс. К 90 минуте, по-

видимому, происходит адаптация клеток, и зависимость от Dps снимается.

Тенденция к адаптивному снижению зависимости от Dps для этих промоторов

наблюдалась и в условиях холодового стресса (Рис. 10Б). Но активность

промоторного кластер Р3-Рdps (фиолетовые столбики), оказалась менее зависимой

и от Dps и от фазы роста. Тем не менее, при температурах, отличающихся от

оптимальных, белок Dps может принимать участие в подавлении экспрессии

собственного гена. Это, вероятно, дает возможность клеткам адаптироваться к

новым условиям роста, без экстренной упаковки генома, которая запускается

белком Dps.

- 16 -

Рис. 10 Изменение активности промоторов dps в клетках E coli K12 MG1655 и K12 MG1655∆dps в

ответ на температурный стресс, вызванный переносом культуры, достигшей OD=0.6 в термостат с

указанной температурой. Условия роста указаны над дорожками. По оси Y отложена активность β-

галактозидазы в единицах Миллера в пересчете на количество клеток. Время воздействия указано на

оси абсцисс.

При

температурных

вариациях

был

зарегистрирован

не

только

ингибиторный (Рис. 10), но и активаторный эффект. Он имел место при переносе

культуры в 30°С и был более очевиден через 60-90 минут после смены

температуры в присутствии промотора P3. Поскольку рост при 30°С, по сути,

представляет собой несколько замедленный рост в физиологических условиях,

можно предположить, что «превращение» Dps из слабого ингибитора в

активатор своего гена связано с переходом клеток на более позднюю фазу роста,

во время которой клетки продуцируют огромное количество Dps для

конденсации хроматина.

Рис. 11 Изменение активности промоторов dps в клетках E coli K12 MG1655 и K12

MG1655∆dps А: при перемещении клеток на рост из 37°С в 30°С; Б: во времени при росте

клеток на 37°С По оси Y отложена активность β-галактозидазы в единицах Миллера в

пересчете на количество клеток. Время воздействия указано на оси абсцисс.

Поэтому мы отследили динамику изменения активности промоторов в

процессе роста при 37°С (Рис. 11). Клетки сначала растили 2 часа до ранней

экспоненциальной фазы (OD600=0.03-0.05) и затем измеряли активность

промоторов каждые 30 минут. Для промоторов P2-Pdps (синие и голубые

столбики) снова была обнаружена явная негативная зависимость от Dps, которая

снижалась к 5 часам роста. А для промоторов P3-Pdps (фиолетовые и светло-

- 17 -

фиолетовые столбики) ингибирующий эффект Dps снова практически не

регистрировался, но после 4.5 часов роста Dps начинал активировать

траскрипцию репортерного гена. Поэтому его активность в мутантном штамме

снижалась по сравнению с клетками дикого типа. Т.е. прямое или косвенное

участие Dps в регуляции экспрессии собственного гена, опосредованное

функционированием промотора P3, можно считать доказанным. Поэтому

следующей задачей стала проверка способности Dps связываться с промоторной

областью dps, а также локализация сайтов этого взаимодействия.

Рис. 12 А: Электрофорез с задержкой в геле комплексов, формируемых очищенным белком Dps со

смесью фрагментов ДНК, содержащих промоторы Р2-Рdps (259 п.н.) и только Р3 (214 п.н.). На 2 и 5

дорожки нанесено по 1 пмоль этих фрагментов ДНК. На 3 и 4 дорожки нанесена смесь этих

фрагментов и Dps после 30 минутной инкубации при 37°С. [Б] Футпринтинг ДНКазой I комплексов

Dps с фрагментами ДНК, амплифицированными с праймерами 2-3 (P3-Pdp), 1-2 (P2-Pdps), и 3-4 (P3).

Праймеры, меченные

Р, отмечены звездочками. Штрихами показаны сайты защиты от гидролиза.

Молярное соотношение белка к ДНК показано над дорожками; В: Схема, иллюстрирующая

относительное расположение и структурную организацию анализируемых фрагментов. Прямые и

инвертированные повторы отмечены стрелками. Соответствующие полосы на панели Б отмечены

открытыми и серыми стрелками, соответственно.

Методом задержки ДНК-белковых комплексов в условиях конкуренции

двух фрагментов было установлено, что белок Dps способен взаимодействовать с

собственной регуляторной областью. Кроме того, он лучше связывает ее

проксимальную часть, что указывает на некоторую селективность его

- 18 -

32

взаимодействия с ДНК (Рис. 12А). Для футпринтинга комплексы были

сформированы с двукратным, пятикратным и десятикратным избытком белка

(Рис. 12Б). При 10-кратном избытке белка мы наблюдали множественные

гиперчувствительные сайты и протяженные области защиты, локализованные

преимущественно на концах фрагментов (Рис. 12Б). Однако при 5-кратном

избытке Dps защищенными оказались всего несколько позиций, находящиеся

рядом с Р1’ и P3, что свидетельствует о позиционной селективности Dps.

Способность промоторной области гена dps избирательно связываться с

белком Dps была подтверждена в экспериментах pull-down (Рис. 13) Видно, что

одним из мажорных белков, взаимодействующих с иммобилизованными на

магнитных шариках промоторными фрагментами ДНК, оказался полипептид, с

молекулярной

массой

~19

kDa,

который

был

идентифицирован

масс-

спектрометрически как Dps. В качестве контроля специфичности метода был

использован фрагмент ДНК, содержащий участок регуляторной области между

генами yjjM (кодирует фактор транскрипции) и yjjN (L-галактонатредуктаза)

(Рис.13 левая панель). Видно, что профиль белков, связавшихся с этим участком,

существенно отличается от белков, связавшихся с регуляторной областью dps.

Полипептид с Mw ~ 19 kDa среди них тоже есть, но не является мажорным.

Рис. 13 Электрофоретическое разделение белков, специфически связавшихся с фрагментами

регуляторной области dps в результате экспериментов pull-down. В качестве контроля была взята

промоторная область между генами yjjM и yjjN E.coli. Электрофоретическое фракционирование

клеточных лизатов, полученных после индукции экспрессии гена dps в трансформированных

соответствующими плазмидами клетках E. coli BL21* (DE3). На дорожку «К» нанесены лизаты

контрольных клеток E. coli BL21* (DE3), содержащих плазмиду без вставки промоторов dps.

Так как факторы транскрипции, как правило, присутствуют в клетках

бактерий в низких концентрациях, нет ничего удивительного в том, что мы не

наблюдаем комплексов с другими регуляторами гена dps (указаны на Рис.

1).Таким образом, Dps принимает участие в контроле экспрессии собственного

гена

(Рис. 9-11) способен к специфическому связыванию с собственной

регуляторной областью (Рис. 12) и является одним из основных белков,

взаимодействующих с ней in vitro (Рис. 13). Т.к. результаты функционального

- 19 -

анализа свидетельствуют о способности Dps активировать и ингибировать

экспрессию своего гена, можно было предположить наличие в клетке лиганда,

вызывающего это переключение. Поэтому на следующем этапе исследовали

способность промоторов гена dps взаимодействовать не с очищенным белком

Dps, а с белком, присутствующим в лизатах клеток в его естественной форме.

Уровень суперпродукции Dps показан на Рис. 14A. Он не очень велик, но

оказался достаточным для того, чтобы почти полностью связать ДНК-мишени.

При этом в отличие от всех предыдущих экспериментов, выполненных с

очищенным белком (см., например, Рис. 12А), мы впервые увидели вошедшие в

гель комплексы (Рис. 14Б).

Рис. 14 А: Фракционирование клеточных лизатов, полученных после индукции экспрессии гена dps в

трансформированных плазмидой pGEM_dps клетках E. coli BL21*(DE3). На дорожку «К» нанесены

лизаты контрольных клеток E. coli BL21*(DE3). Б: Электрофорез с задержкой в геле комплексов,

формируемых указанными фрагментами регуляторной области гена dps c лизатом клеток, после

индукции биосинтеза Dps 1 мМ IPTG. В: Western-блот с антителами к белку Dps.

Важно, что в комплексах, зарегистрированных Western-блоттингом, был

идентифицирован именно Dps (Рис. 14В), а фрагмент с промоторами P3+P2

взаимодействовал с Dps эффективнее (дорожки 6 и 8), чем проксимальная к гену

область (дорожки 5 и 7). Исходя из электрофоретической подвижности

комплексов, можно предположить, что ДНК-фрагменты взаимодействуют не

только с додекамерами Dps (находятся вверху геля), но и с олигомерами менее

высокого порядка (гексамерами, тримерами и димерами). Тот факт, что все они

вошли в гель, свидетельствует против характерной для белка Dps агрегации и,

следовательно,

о

присутствии

в

клетках

лиганда,

препятствующего

олигомеризации Dps, и влияющего на характер его взаимодействия с ДНК.

5. Поиск регуляторов, участвующих в модуляции экспрессии гена dps

Поскольку нативный промотор Р3, почти не обладая транскрипционной

активностью, вносит существенный вклад в активацию транскрипции гена dps,

логично было предположить наличие рядом с ним каких-либо дополнительных

регуляторных сигналов. С использованием интернет ресурса Virtual footprint

- 20 -

[Munch et al., 2005] для поиска потенциальных мест связывания 58 регуляторов с

известными на данный момент консенсусами в регуляторной области гена dps

были найдены сайты для 5 новых регуляторов. Большинство из них локализуется

на дополнительных промоторах особенно вблизи Р3. Среди них оказались OmpR,

принимающий участие в осморегуляции и GntR - регулятор метаболизма

глюконата, сайт которого перекрывается с сайтом ArgR - регулятором

биосинтеза аргинина. Сайты GntR и других белков этого семейства почти всегда

перекрываются с местами связывания регуляторов сахарного метаболизма. В

данном случае, на последовательности Р3 был найден потенциальный сайт

связывания глобального регулятора углеводного метаболизма cAMP-CRP. Кроме

того, с последовательностью ДНК вблизи дополнительных промоторов гена dps

потенциально могут связываться регуляторы биосинтеза метионина MetJ и MetR,

регулятор генов метаболизма азота Nac, а также регулятор экспрессии генов,

кодирующих ферменты расщепления глицина GcvA. Вблизи стартовой точки Р2

было обнаружено дополнительное место возможной посадки белка нуклеоида H-

NS – первое было ранее картировано с центром в позиции +3.5 относительно

стартовой точки основного промотора Pdps (Рис. 17, [Grainger et al., 2008]).

Для проверки этих предсказаний был осуществлен экспериментальный

поиск факторов транскрипции, ассоциированных с регуляторной областью гена

dps, с помощью метода «DNA-sampling», который позволяет идентифицировать

все белки, связанные с исследуемым фрагментом в условиях in vivo, а не in vitro,

как в pull-down экспериментах. Для тестирования была взята вся регуляторная

область гена dps (праймеры 2-3 Рис. 1). Все белки, связавшиеся с исследуемым

участком, были идентифицированы с помощью жидкостной хромато-масс-

спектрометрии LC/MS.

В результате анализа полученных данных среди них был обнаружен один

полноразмерный белок - регулятор двойного действия MetR. Он регулирует гены

биосинтеза метионина, который инициирует трансляцию у прокариот. В

отсутствие метионина MetR уходит с репрессируемых промоторов, запуская тем

самым транскрипцию генов, отвечающих за его биосинтез. Не исключено, что

MetR связывается с регуляторной областью гена dps, тоже в качестве репрессора,

для того, чтобы предотвратить или замедлить конденсацию нуклеоида и

остановку роста бактерии при наличии аминокислот. То есть, MetR в данном

случае может играть роль одного из факторов, сопрягающих метаболический

статус

клетки

и

активность

генома.

К

сожалению,

среди

полностью

идентифицированных белков опять не оказалось ни одного из известных

регуляторов экспрессии гена dps и не оказалось Dps. Поэтому более детальному

анализу были подвергнуты все идентифицированные в высокой концентрации

пептиды, которые представляли собой фрагменты следующих регуляторов

транскрипции: SdiA, cAMP-CRP, ExuR, LysR, FNR, ZraR, DeoR, EvgA, GntR,

MntR, NhaR. С помощью такого подхода нам удалось обнаружить известный

ранее репрессор гена dps MntR, а также некоторые факторы транскрипции,

предсказанные с помощью Virtual Footprint (CRP, NhaR и GntR). Но среди них

тоже

не

оказалось

белка

Dps,

что,

по-видимому,

свидетельствует

об

относительно низком сродстве этого белка к собственной промоторной области,

по крайней мере, во время экспоненциального роста клеток.

- 21 -

Тем не менее, мы обнаружили, что с регуляторной областью dps, кроме

MetR, могут связываться и другие регуляторы метаболических генов, в

частности генов углеводного метаболизма. Это было не совсем ожидаемо,

поэтому мы решили проверить, действительно ли cAMP-CRP, имеющий два

потенциальных сайта связывания вблизи промоторов P3 и P1’, может

взаимодействовать с содержащими эти сайты фрагментами ДНК.

Рис. 15 А: Электрофоретическое фракционирование клеточных лизатов, полученных после индукции

экспрессии гена crp в трансформированных плазмидой pET28b_CRP клетках E. coli BL21*(DE3). В

качестве контроля были использованы клетки E. coli BL21*(DE3), не содержащие плазмиды с crp. Б:

Электрофорез с задержкой в геле комплексов, формируемых указанными фрагментами регуляторной

области гена dps c лизатом клеток, после индукции биосинтеза CRP 0.1 мМ IPTG. Гель был окрашен

бромистым этидием и визуализирован на трансиллюминаторе.

Для этого мы использовали метод задержки ДНК-белковых комплексов

фрагментов регуляторной области гена dps с растворимыми белками клеток,

суперпродуцирующих CRP. В результате индукции в полученной фракции

растворимых белков находилось более 80% CRP (Рис. 15А). В соответствии с

тем, что сайты связывания CRP были предсказаны на промоторах P3 и P1',

вошедший в гель комплекс виден с фрагментом, содержащим эти промоторы

(праймеры 1** и 9 на Рис. 1, Рис. 15Б). Его специфичность была подтверждена с

помощью Western-блот-гибридизации с антителами к белку CRP. Убыль

свободной ДНК при увеличении концентрации белка свидетельствует о

возможном контакте CRP и со вторым фрагментом ДНК, содержащим Рdps и Pa1

(праймеры 7** и 10 на Рис. 1, Рис. 15Б). Он может быть опосредован и другими

регуляторами гена dps (Рис. 1), например Fis и H-NS, которые присутствуют в

клетках в больших количествах, хотя убыли свободной ДНК при добавлении

контрольного лизата (дорожки «К») не наблюдалось.

Неожиданной находкой среди пептидов, ассоциированных с регуляторной

областью гена dps, оказались пептиды регулятора ExuR, контролирующего

транспорт и метаболизм галактуроната и глюкуроната. Его связывание с

промоторами P3 и Р2 подтверждают данные ChIP-seq с антителами к белку ExuR,

при котором все участки ДНК, образовавшие комплексы с ExuR в клетке, были

собраны с помощью соответствующего антитела и подвергнуты прямому

- 22 -

секвенированию. Причем один из сайтов связывания, вблизи дополнительного

промотора Р2 наблюдается при росте клеточной культуры на D-глюкозе и на D-

глюкуронате. Другой сайт находится в позиции -41 от стартовой точки

транскрипции промотора P3. Он зарегистрирован только при росте клеток на

глюкозе. Его расположение относительно P3 позволяет отнести его к активатору

II класса. Для проверки этой гипотезы, а также для оценки влияния на

экспрессию dps другого регулятора углеводного метаболизма, cAMP-CRP, с

помощью метода qRT-PCR был определён уровень dps-мРНК в клетках дикого

типа и делеционных мутантов по генам crp и exuR.

Рис. 16 Изменения уровня транскрипции с промоторов Р3-Pdps (праймеры 6 и 5) и, отдельно, Р3

(праймеры 1* и 8), зарегистрированные методом qRT-PCR. Показан относительный уровень мРНК. В

качестве контроля были использованы клетки дикого типа K12 MG1655, растущие на глюкозе.

Эксперименты проведены в трех биологических и двух технических повторностях. Расположение

праймеров см. на Рис.1

Поскольку оба эти белка являются регуляторами метаболизма сахаров, то

клетки выращивали на глюкозе или глюкуронате в качестве основного источника

питания. Транскрипционная активность полного набора промоторов гена dps

(образцы Р3-Рdps) явно возрастала при росте на глюкуронате по сравнению с

ростом на глюкозе (зелёные столбики в первых двух группах Рис.16). Эта

стимуляция, как минимум, частично опосредована белком ExuR, т.к. его

отсутствие

практически

полностью

элиминировало

активацию

(красные

столбики в этих же группах). На глюкозе, ExuR, напротив, выполнял

ингибиторную функцию (красный и зелёный столбик в первой группе), что

может говорить о вкладе этого белка в поддержание транскрипции dps на уровне,

необходимом клетке в тех или иных условиях роста. CRP при этом играл роль

активатора независимо от условий роста (серые столбики в первых двух

группах). Это хорошо согласуется с расположением его сайта с центром в

позиции -46,5 относительно стартовой точки Pdps, что типично для активаторов II

класса, которые связываются с UP-элементами промоторов и контактируют

αCTD (Рис. 17).

Достоверных изменений в уровне транскрипции с P3 при росте на глюкозе

зарегистрировано не было, но при росте на глюкуронате в отсутствии CRP мы

наблюдали небольшое угнетение опосредованной им транскрипции, что может

свидетельствовать об активации этого промотора CRP. Целесообразность этой

активации может быть связана с тем, что при росте клеток на альтернативных

- 23 -

источниках углерода, к которым относится и глюкуронат, переход к

стационарной фазе роста происходит раньше, чем при росте на глюкозе, и в

таком случае клеткам требуется активация синтеза Dps, которая может

осуществляться и самим белком Dps (Рис. 11).

На Рис. 17 приведена схема расположения всех известных на данный

момент регуляторов транскрипции гена dps, включая обнаруженные нами в этой

работе. Видно, что многие из них находятся рядом с дополнительными

промоторами. Рядом с Р3, например, могут связываться ExuR, CRP и сам Dps.

Рис. 17 Расположение сайтов связывания факторов транскрипции, способных принимать участие в

регуляции экспрессии гена dps. Красным цветом обозначены репрессоры, зеленым – активаторы.

Голубым отмечены регуляторы с двойной функцией, серым – белки с пока неизвестной функцией.

CRP является глобальным метаболическим регулятором, контролирующим

экспрессию сотен генов. По нашим данным, полученным, в частности методом

ChIP-seq, регулон ExuR тоже довольно многочисленный. Участие этих белков в

регуляции

гена

структурного

белка

нуклеоида

можно

объяснить

необходимостью сопряжения метаболического статуса клетки и структурного

состояния генома. Однако расположение сайтов связывания регуляторов

клеточного

метаболизма

в

удалённой

от

основного

промотора

части

регуляторной области гена (Рис. 17) наводит на мысль о независимой эволюции

проксимальной и дистальной части промоторной области гена dps. Это

соответствует предположению о том, что дистальная часть этой области

появилась в геноме E. coli в результате горизонтального переноса, а полученные

данные

позволяют

предположить,

что

донором

этой

нуклеотидной

последовательности был ген, кодирующий ферменты или белки метаболических

путей. Очевидно, что перенесённый фрагмент был удачно ассимилирован, с

приобретением

кишечной

палочкой

дополнительной

возможности

координировать генную экспрессию.

Механизм активаторного действия P3 остался не до конца понятным.

Совершенно ясно, что именно этот промотор вносит основной вклад в

аллостерическую активацию Pdps. Ясно также, что этот вклад не аддитивен, т.е.

не

сводится

к

добавлению

транскриптов,

с

низкой

эффективностью

инициированных на большом расстоянии от начала гена. Не исключено, что

основное значение имеют не синтезированные транскрипты, как таковые, а

- 24 -

опосредованное взаимодействием с РНКП поддержание регуляторной области

гена dps в активном состоянии. В таком случае промотор P3 следует

рассматривать, как сайт связывания регуляторного белка, на котором РНКП

выполняет несвойственную ей роль активатора транскрипции.

ВЫВОДЫ.

1. В регуляторной области гена dps, кроме известного промотора Pdps,

обнаружены дополнительные промоторы как для антисмысловой, так и для

смысловой

транскрипции.

Несмотря

на

низкую

активность

смысловых

промоторов, они необходимы для максимальной экспрессии гена, причём вклад

промотора

P3

непропорционален

его

собственной

транскрипционной

активности.

2. Впервые показано, что белок Dps способен к специфическому связыванию с

собственной регуляторной областью и принимает участие в контроле экспрессии

собственного гена.

3. Белок Dps, являясь структурным фактором нуклеоида, в зависимости от

условий может быть как активатором, так и репрессором собственного гена, т.е.

является важным фактором, способным сопрягать метаболический статус клетки

со структурно-функцилональным состоянием генома.

4. Установлено, что регуляторная область гена dps имеет сайты связывания

для

11

новых

регуляторов

транскрипции.

Взаимодействие

с

ней

экспериментально

зарегистрировано

для

регулятора

генов

биосинтеза

метионина (MetR), глобального регулятора клеточного метаболизма CRP и

регулятора углеводного метаболизма ExuR.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ

Статьи в рецензируемых журналах, входящих в список ВАК РФ

1. Shvyreva US, Tutukina MN, Ozolin' ON. (2011) Bacterioferritin: properties,

structural and functional organization of the dps gene regulatary region.//

Biofizika., 56(5):821-30.

2. Покусаева В.О., Антипов С.С., Швырева У.С., Тутукина М.Н., Озолинь

О.Н. (2012) Суперпродукция, выделения и очистка функционально

активного

бактериоферритина

Dps

E.

coli.

//

Сорбционные

и

хроматографические процессы. Т. 12. № 6. С. 1011-1017.

3. Melekhov VV, Shvyreva US, Timchenko AA, Tutukina MN, Preobrazhenskaya

EV, Burkova DV, Artiukhov VG, Ozoline ON, Antipov SS. (2015) Modes of

Escherichia coli Dps Interaction with DNA as Revealed by Atomic Force

Microscopy. // PLoS One., 10(5):e0126504.

4. Тутукина М.Н., Швырева У.С., Озолинь О.Н. (2015) Суперпродукция

архитектурного фактора бактериального нуклеоида H-NS и оценка его

- 25 -

функциональной

активности.

//Сорбционные

и

хроматографические

процессы. Т. 15. № 3. С. 435-442.

5. Швырева У.С., Тутукина М.Н., Озолинь О.Н. (2015) «Промоторные

островки» генома E. coli как мишени для сорбции ферментов процессинга

РНК. // Сорбционные и хроматографические процессы. Т. 15. № 4. С. 586-

594.

Статьи в научных сборниках

6. Швырева У. С., Тутукина М. Н., Озолинь О. Н., Епринцев А. Т. (2009)

Клонирование гена dps E. coli в экспрессионный вектор pGEMAX.//

«Организация и регуляция физиолого-биохимических процессов», Вып. 10,

ВГУ –№1 - стр. 73-75.

Тезисы докладов

7. Швырева У. С., Тутукина М. Н., Озолинь О. Н. Картирование промоторов

регуляторной области гена dps E. coli. // Материалы XXII зимней школы-

конференции молодых ученых «Перспективные направления Физико-

химической биологии и биотехнологии” – Москва, 2010- стр. 156-157

8. Швырева У. С., Тутукина М. Н., Озолинь О. Н. Изменение активности

промоторов регуляторной области гена dps в клетках E. coli под действием

электромагнитного излучения сверхвысокой частоты. // Материалы 14

Пущинской

международной

школы-конференции

молодых

ученых

«Биология наука XXI века"- 2010 - стр. 202-203

9. Shvyreva U. S., Tutukina M. N., Ozoline O. N. Study of bacterioferritin

properties under electromagnetic irradiation to develop the base for controllable

interaction with DNA.// Proceedings of the 2nd International Congress-

partnering& exhibition on biotechnology and bioenergy “EurasiaBio-2010” –

Москва, 2010 – pp. 359-360

10. Shvyreva U., Tutukina M., Ozoline O. Additional promoter-like site with ability

to activate dps promoter// Proceedings of the EMBO meeting 2010 – Barcelona,

2010- p. 91

11. Мелехов В.В., Швырева У.С., Тимченко А.А., Озолинь О.Н., Антипов С.С.

Конформационные особенности нативного белка Dps, его апо-формы и

насыщенного ионами железа. // Материалы 18 Пущинской международной

школы-конференции молодых ученых «Биология наука XXI века"- 2014 -

стр. 103-104

12. U.S. Shvyreva, S.S. Antipov, M.N. Tutukina, O.N.Ozoline Regulation of the dps

gene expression by the Dps protein// Proceedings of the 2nd International

Workshop on Biology and physics of bacterial chromosomes - Birmingham,

UK, 2014

13. M. Tutukina, U. Shvyreva, I. Suvorova, J. Cole, O. Ozoline Two isoforms of the

YjjM transcription factor differing in the DNA-binding domains// Proceedings

of the 6th FEMS Congress - Maastricht, 2015 – p.1985.

- 26 -



 
Похожие работы:

«УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ БЕЛОРУССКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ УДК: 616.24-036.12-052-06:616.155.32 КАДУШКИН Алексей Геннадьевич ОСОБЕННОСТИ ЛИГАНД-РЕЦЕПТОРНЫХ ВЗАИМООТНОШЕНИЙ В ПОПУЛЯЦИИ ЛИМФОЦИТОВ КРОВИ И ИХ ПРОГНОСТИЧЕСКАЯ РОЛЬ У КУРЯЩИХ И НЕКУРЯЩИХ ПАЦИЕНТОВ С ХРОНИЧЕСКОЙ ОБСТРУКТИВНОЙ БОЛЕЗНЬЮ ЛЕГКИХ Автореферат диссертации на соискание ученой степени кандидата медицинских наук по специальности 03.01.04 – биохимия Минск 2015 Научная работа выполнена в учреждении образования...»

«МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ ГОСУДАРСТВЕННОЕ УЧРЕЖДЕНИЕ РЕСПУБЛИКАНСКИЙ НАУЧНО-ПРАКТИЧЕСКИЙ ЦЕНТР ТРАНСФУЗИОЛОГИИ И МЕДИЦИНСКИХ БИОТЕХНОЛОГИЙ УДК 616.155.392-021.3-07-036 КЛИМКОВИЧ Наталья Николаевна ПЕРВИЧНЫЕ МИЕЛОДИСПЛАСТИЧЕСКИЕ СИНДРОМЫ: МЕДИКО-БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА, ДИАГНОСТИКА, КРИТЕРИИ ПРОГНОЗА Автореферат диссертации на соискание ученой степени доктора медицинских наук по специальности 14.01.21 – гематология и переливание крови Минск 2015 Работа выполнена в...»

«УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ БЕЛОРУССКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ УДК 616.314.26-007.24/.26-089.23/.25 ОСТАПОВИЧ Алексей Андреевич ПРИМЕНЕНИЕ НИЗКОЧАСТОТНОГО УЛЬТРАЗВУКА И АСКОРБИНОВОЙ КИСЛОТЫ ДЛЯ ЛЕЧЕНИЯ ПАЦИЕНТОВ С ЗУБОЧЕЛЮСТНЫМИ АНОМАЛИЯМИ И ДЕФОРМАЦИЯМИ В СФОРМИРОВАННОМ ПРИКУСЕ (ЭКСПЕРИМЕНТАЛЬНО-КЛИНИЧЕСКОЕ ИССЛЕДОВАНИЕ) Автореферат диссертации на соискание ученой степени кандидата медицинских наук по специальности 14.01.14 – стоматология Минск 2015 Научная работа выполнена в...»





 
© 2015 www.z-pdf.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.