авторефераты диссертаций www.z-pdf.ru
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
 

УДК 633.289: 631.523

На правах рукописи

КХУАТ ТХИ МАЙ ЛЫОНГ

АНАЛИЗ ОРГАНИЗАЦИИ ПОВТОРЯЮЩИХСЯ

ПОСЛЕДОВАТЕЛЬНОСТЕЙ ДНК В ГЕНОМАХ ДИКОРАСТУЩИХ

СОРОДИЧЕЙ ПШЕНИЦЫ

Специальность 03.02.07 – генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва 2015

Дивашук Михаил Георгиевич, кандидат

биологических

наук,

старший

научный

сотрудник

Центра

молекулярной

биотехнологии ФГБОУ ВО «Российский

государственный аграрный университет –

МСХА имени К.А.Тимирязева»

Драгович Александра Юрьевна,

доктор биологических наук, заведующая

лабораторией генетических основ

идентификации растений, отдела генетики

растений, ФГБУН Институт общей генетики

им. Н.И. Вавилова РАН

Шилов Илья Александрович,

доктор биологических наук, заведующий

лабораторией анализа геномов, ФГБНУ

«Всероссийский научно-исследовательский

институт сельскохозяйственной

биотехнологии»

ФГБНУ «Федеральный исследовательский

центр Всероссийский институт генетических

ресурсов растений имени Н.И. Вавилова»

(ВИР)

Научный руководитель:

Официальные оппоненты:

Ведущая организация:

Работа выполнена в Центре молекулярной биотехнологии Федерального

государственного

бюджетного

образовательного

учреждения

высшего

образования «Российский государственный аграрный университет – МСХА

имени К.А.Тимирязева»

Защита состоится 25 февраля 2016 г. в 14-30 на заседании диссертационного

совета Д 220.043.10 на базе ФГБОУ ВО «Российский государственный аграрный

университет – МСХА имени К.А. Тимирязева» по адресу: 127550, Москва,

ул. Прянишникова, д. 19, тел./факс +7(499) 976-17-14.

С диссертацией можно ознакомиться в Центральной научной библиотеке

им. Н.И. Железнова РГАУ-МСХА имени К.А. Тимирязева и на сайте

http://timacad.ru

Автореферат разослан «____» декабря 2015 г.

Ученый секретарь

диссертационного совета

2

Л.С. Большакова

Общая характеристика работы

Актуальность.

Большую

часть

растительного

генома

составляют

повторяющиеся последовательности ДНК (Flavell et al., 1992; Voytas et al., 1992;

Schmidt & Heslop-Harrison, 1998; Charles et al., 2008). Они гетерогенны и

отличаются между собой по копийности, длине, нуклеотидному составу,

характеру локализации в геноме. Повторяющуюся ДНК можно объединить в

отдельные семейства в зависимости от организации, выявляемым доменам и

распределению

в

геноме.

Предположительно,

повторяющиеся

последовательности ДНК участвуют в стабилизации и поддержании хромосомной

структуры, в «узнавании» хромосом в процессе клеточного деления и их

правильном

расхождении.

Видообразование,

в

том

числе

алло-

и

автополиплоидизация

растений,

зачастую

сопровождается

значительными

изменениями в повторяющейся ДНК, прежде всего в изменении её копийности.

Дикорастущие

виды

пырея,

такие

как

Thinopyrum

intermedium,

Th. bessarabicum, а также некоторые виды родов Pseudoroegneria и Dasypyrum,

являются донорами хозяйственно ценных признаков и используются в отдаленной

гибридизации мягкой пшеницы (Цицин, 1978; Larkin et al., 1995; Chen et al., 2003;

Yang et al., 2006; Luo et al., 2009). Изучение повторяющихся последовательностей

ДНК этих видов c применением современных подходов в области молекулярной

цитогенетики позволит получить дополнительные знания по эволюции семейства

Злаковых. Наряду с этим на основе повторяющихся последовательностей ДНК

возможно создание цитогенетических маркеров, специфичных для данных видов

и/или их отдельных хромосом, что может быть использовано для характеристики

как коллекций растительного материала, полученного путем отдаленной

гибридизации, так и непосредственно в ходе самого селекционного процесса.

В целом же изучение различных семейств повторяющейся ДНК и их

структурной организации в хромосоме актуально для пополнения наших знаний о

функции и эволюции повторяющейся ДНК у растений.

Цель работы. Цель данной работы – изучить хромосомную организацию

повторяющихся последовательностей ДНК в геномах дикорастущих сородичей

пшеницы.

Для достижения поставленной цели были сформулированы следующие

задачи:

1. Изучить организацию различных ретроэлементов на уровне хромосом у

дикорастущих сородичей пшеницы.

2. Методами

биоинформатики

выявить

высококопийные

тандемно-

организованные последовательности ДНК в геноме мягкой пшеницы.

3. Методами гибридизации in situ провести физическое картирование

выявленных повторяющихся последовательностей ДНК на хромосомах

Th. intermedium, P. spicata, D. villosum и Th. bessarabicum.

Научная новизна. Впервые показана локализация центромерного Ty3/gypsy

ретротранспозона в центромерах всех хромосом Th. bessarabicum, P. spicata,

D. villosum и Th. intermedium. Анализ копийности центромерного Ty3/gypsy

ретротранспозона по результатам FISH показал, что у аллополиплоида

Th. intermedium копийность различна по субгеномам. Установлена локализация на

3

хромосомах и показана возможность использования в качестве цитогенетических

маркеров для FISH анализа хромосом Th. bessarabicum, P. spicata, D. villosum и

Th. intermedium тандемных повторов П720, П170, П322, П631, П523, П431 и П496,

выявленных в геноме мягкой пшеницы. Впервые показана локализация двух

тандемных повторов (П170 и П496) на хромосомах пшеницы.

Теоретическая

и

практическая

значимость

работы.

Результаты,

полученные

в

данной

работе,

имеют

теоретическое

значение

для

фундаментальных исследований структурной организации и эволюции хромосом

злаков. Большое значение имеют данные, полученные с использованием методов

молекулярной цитогенетики, о геномах St, Jb, V, Jr, Jvs у разных видов злаковых.

Выявленные тандемные повторы пшеницы могут быть использованы как

цитогенетические маркеры для идентификации отдельных субгеномов, а также

индивидуальных хромосом дикорастущих сородичей пшеницы, что важно в

агробиотехнологиях при создании сортов пшеницы с использованием методов

хромосомной инженерии.

Методология и методы диссертационного исследования. Диссертация

выполнена с использованием современных, хорошо зарекомендовавших себя

методов молекулярной цитогенетики, филогенетики и биоинформатики, на

современном оборудовании. Полностью методология и методы исследования

отражены в разделе «Материалы и методы».

Положения, выносимые на защиту:

1. Центромерные

Ty3/gypsy

ретротранспозоны

локализованы

в

центромерах всех хромосом видов: Th. bessarabicum, P. spicata,

D. villosum и Th. intermedium. У аллополиплоида Th. intermedium

копийность цетромерного Ty3/gypsy ретротранспозона различна по

субгеномам.

2. Тандемные повторы, выявляемые в геноме мягкой пшеницы с

помощью биоинформационного анализа данных NGS, возможно

использовать в качестве цитогенетических маркеров для FISH анализа

хромосом её дикорастущих сородичей.

3. На хромосомах Th. bessarabicum локализуются пять тандемных

повторов (П720, П170, П631, П431 и П496), выявленных в геноме

мягкой пшеницы.

4. На хромосомах P. spicata локализуются два тандемных повтора (П720

и П631), выявленных в геноме мягкой пшеницы.

5. На хромосомах D. villosum локализуются два тандемных повтора (П720

и П322), выявленных в геноме мягкой пшеницы.

6. На

хромосомах

Th. intermedium

локализуются

семь

тандемных

повторов (П720, П170, П322, П631, П523, П431 и П496), выявленных в

геноме мягкой пшеницы.

Степень достоверности и апробация результатов. Результаты работы

опубликованы в 5 печатных работах, в том числе в 3 статьях в журналах из списка

ВАК, из них одна – в рецензируемом международном и две – в российских

журналах. Ключевые результаты работы были доложены на международных и

российских конференциях: Plant molecular cytogenetics in genomic and postgenomic

4

era (University of Silesia in Katowice Poland, 2014), VI съезд Вавиловского

общества генетиков и селекционеров (ВОГиС) и ассоциированные генетические

симпозиумы г. Ростов-на-Дону, 15–20 июня 2014 г. и на ежегодных конференциях

молодых ученых и преподавателей РГАУ-МСХА имени К.А.Тимирязева.

Личный вклад автора. Автор принимал непосредственное участие в

диссертационной работе на всех её этапах. Исследование центромерного повтора

– совместно с И.В. Кировым под руководством М.Г. Дивашука и Г.И. Карлова,

выявление тандемных

повторов пшеницы

совместно

с

лабораторией

биоинформатики ФГБУ ФНКЦ ФХМ ФМБА России, остальные разделы

диссертации – самостоятельно под руководством М.Г. Дивашука. Автор лично

проводил обработку, анализ и интерпретацию всех полученных результатов, а

также

подготовку

и

оформление

публикаций

и

рукописи,

принимал

непосредственное участие в разработке программы исследований, планировании

и проведении экспериментов. Результаты диссертационной работы обобщены

совместно

с

научным

руководителем

М.Г. Дивашуком,

текст

рукописи

подготовлен самостоятельно. Автор принимал непосредственное участие в

написании и подготовке к публикации печатных работ.

Публикации. По материалам диссертации опубликовано 5 печатных работ,

из них 3 в рецензируемых журналах из списка ВАК.

Объем и структура диссертации. Материалы диссертации изложены на

165 страницах машинописного текста и включают 72 рисунка, 3 таблицы.

Диссертация состоит из введения, трех глав, включая обзор литературы,

материалы и методы, результаты и обсуждение, заключения, выводов, списка

литературы, содержащего 293 источника, из них 289 – на английском языке, а

также приложения.

Содержание диссертации.

ГЛАВА 1. Обзор литературы

В главе приведен аналитический обзор литературы по изучаемой проблеме.

Представлены

классификация

и

филогения

трибы

Triticeae.

Подробно

рассмотрены происхождение и значимость гексаплоидной пшеницы (Triticum

aestivum L.) и рода Thinopyrum. Представлены особенности генетических

отношений между геномами St, E, A, B и D в Triticeae. Рассмотрена общая

характеристика повторяющихся последовательностей ДНК, типы, структуры и

распределение ретротранспозонов в растениях, филогения и транспозиционная

активность Ty1/copia и Ty3/gypsy групп ретротранспозонов в геномах злаков,

активация ретротранспозонов стрессовыми факторами и роль ретротранспозонов

в качестве мутагенов. Рассмотрены тандемные повторы в растениях, сателлитные

повторы и центромерные ретротранспозоны.

ГЛАВА 2. Объекты и методы исследования.

Материалом в данной работе послужили образцы дикорастущих сородичей

пшеницы Thinopyrum intermedium (JrJvsSt) (PI 401200), Pseudoroegneria spicata (St)

(PI 635993, PI 537371), Pseudoroegneria strigosa (PI 639805, PI 595164), Dasypyrum

villosum (V) (W6 21717), Thinopyrum bessarabicum (Jb) (PI 531711) и два сорта

мягкой пшеницы (Triticum aestivum) Иволга и Тулайковская 100.

Th. intermedium является сегментальным аллогексаплоидом (2n=42) с

5

комплексной геномной конституцией. В нашей работе мы использовали

следующую номенклатуру его субгеномов.

Субгеном Jr (=J=E) – при проведении mcGISH (пробы: меченая bio-16-

dUTP ДНК D. villosum и меченая DIG-11-dUTP ДНК P. spicata, блок – мягкая

пшеница) наблюдалась гибридизация только пробы P. spicata в субтеломерной

области хромосом.

Субгеном St (=S=X) – при проведении mcGISH (пробы: меченая bio-16-

dUTP ДНК D. villosum и меченая DIG-11-dUTP ДНК P. spicata, блок – мягкая

пшеница) наблюдалась гибридизация только пробы P. spicata по всей длине

хромосом.

Субгеном Jvs (=Js=(V-J-R)s=(V-J-H)s) является составным субгеномом. В

нем выделяли субгеном Js - с субтеломерными и прицентромерными сигналами

пробы P. spicata (St) и интеркалярными сигналами пробы D. villosum (V) и

субгеном Jv - с только субтеломерными сигналами пробы P. spicata (St) и

интеркалярными и прицентромерными сигналами пробы D. villosum (V), при

проведении mcGISH.

Выделение ДНК из растительного материала. ДНК выделяли из молодых

листьев и проростков объекта исследования согласно протоколу Bernatzky и Tanksley

(1986) с некоторыми модификациями.

ПЦР-анализ. Все праймеры были синтезированы в ЗАО «Синтол»

(Москва). Объем смеси для проведения ПЦР составлял 25 мкл. Условия ПЦР

оптимизировали отдельно для каждой пары праймеров. Продукты ПЦР разделяли в

2 % агарозном геле в TBE-буфере при напряженности поля 6 В/см. В качестве маркера

размеров использовали «100 bp ladder» (Fermentas). После окрашивания бромистым

этидием продукты ПЦР визуализировали с помощью трансиллюминатора и

документировали с помощью прибора GelDoc (BioRad, США).

ПЦР

в

реальном

времени.

Относительное

количество

последовательностей центромерного ретротранспозона в геномах изученных

видов оценивали с помощью метода количественной ПЦР (qPCR) (Baruch &

Kashkush 2012; Kraitshtein et al. 2010; Yaakov et al. 2012; Yaakov et al. 2013).

Клонирование

нуклеотидных

последовательностей.

Лигирование

амплифицированной ДНК осуществлялся в pGEM®-T Easy. Трансформацию

осуществляли в штамм E.coli DH10B методом теплового шока. Отбор клонов

осуществляли с помощью бело-голубой селекции и ПЦР с праймерами M13.

Секвенирование

и

анализ

нуклеотидных

последовательностей.

Секвенирование осуществляли на секвенаторе ABI 3130xl Genetic Analyzer

(Applied Biosystems) с помощью набора Big Dye v3.1 в соответствии с

рекомендациями производителя.

Выравнивание

последовательностей

проводили

с

использованием

программного обеспечения Mega6 (Tamura et al., 2013). Поиск гомологичных

последовательностей

проводили

с

помощью

поиска

BLAST

(http://blast.ncbi.nlm.nih.gov).

Поиск

консервативных

областей

в

пределах

кодирующих нуклеотидных последовательностей проводили с использованием

CDD-поиска

NCBI

( http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi ).

6

помощью

повторов.

программы Tandemrepeat Finder была выявлена серия тандемных

Приготовление хромосомных препаратов

Корешки проростков с вегетирующего растения длиной 1,5-2,5 см

обрабатывали закисью азота N2O в течение 2 часов для накопления метафазных

пластинок. После предобработки корешки фиксировали в 45%-ной уксусной

кислоте в течение 15 мин. при температуре 4оС. Корешки отмывали от фиксатора

в проточной воде в течение 30 мин., потом промывали в холодной

дистиллированной воде. Корешки выдерживали в цитратном буфере pH=4,5 в

течение 15 мин. После отмывки корешки помещали в бюксы со смесью

пектолитических ферментов (0,1% р-р целлюлазы и 0,1% р-р пектолиазы в

цитратном буфере pH=4,5). Обработку проводили на водяной бане при

температуре 37оС в течение 45 мин. Препараты готовили методом «давленых

препаратов».

Флуоресцентная и геномная гибридизация in situ (FISH, GISH)

ПЦР-продукты,

полученные

на

геномной

ДНК

Th. bessarabicum

и

Th. intermedium, были помечены биотин-16-dUTP, геномной ДНК P. spicata -

дигоксигенин-11-dUTP, геномной ДНК D. villosum - биотин-16-dUTP или

дигоксигенин-11-dUTP с помощью ПЦР в соответствии с инструкциями

изготовителя (Roche, Германия); одно- и многоцветный FISH проводили согласно

Karlov et al. (2003).

На препаратах Th. intermedium после процедуры FISH и «отмывки» пробы

(по Komuro et al., 2013) проводилась многоцветная геномная гибридизация in situ

(mcGISH), как описано в работе Kishii et al. (2005) с модификациями, описанными

в работе Salina et al. (2015). В качестве пробы служила геномная ДНК P. spicata

(геном St) и D. villosum (геном V) (50 нг/препарат), меченная дигоксигенин-11-

dUTP и биотин-16-dUTP соответственно, с помощью ник-трансляции в

соответствии с инструкцией производителя (Roche, Германия).

ГЛАВА 3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Верификация объектов исследования. При использовании образцов

дикорастущих злаков в молекулярных и цитогенетических исследованиях во

избежание получения ложных результатов обязательным этапом должна быть

процедура верификации видовой принадлежности изучаемого образца. Это

связанно со сложной ботанической идентификацией и наличием полиплоидных

рядов у дикорастущих злаков. В связи с этим на первом этапе наших

исследований

мы

провели

цитогенетическую

верификацию

видов,

использованных в нашей работе: Th. bessarabicum, P. spicata, D. villosum и

Th. intermedium. При подсчете числа хромосом у видов Th. bessarabicum,

D. villosum и Th. intermedium мы получили ожидаемые результаты – 14, 14 и 42

хромосомы соответственно. Однако при исследовании двух образцов P. spicata и

7

Филогенетический

анализ

проводили

с

использованием

программного

обеспечения Mega6.

Выявление тандемных повторов. На основе баз данных NGS T. aestivum

совместно с лабораторией биоинформатики ФГБУ ФНКЦ ФХМ ФМБА России с

двух образцов P. strigosa было выявлено, что только один образец P. spicata

PI 635993 имеет 14 хромосом и является диплоидом. Другой образец P. spicata

PI 537371 имеет 28 хромосом и является тетраплоидом. Два образца P. strigosa с

номерами PI 595164, PI 639805 имеют 42 хромосомы и являются гексаплоидами.

Для определения геномного состава изучаемых образцов проводили геномную in

situ гибридизацию на тетраплоидной P. spicata (PI 537371) и гексаплоидной

P. strigosa (PI 639805). В качестве пробы для идентификации генома St

использовали меченую тотальную геномную ДНК P. spicata (PI 635993, 2n=14).

Результат GISH показал, что P. spicata (PI 537371) и P. strigosa (PI 639805)

являются аллотетраплоидом и аллогексаплоидом соответственно. В ходе

проведенной нами работы показано, что из 4 проанализированных образцов

только один – PI 635993 – является действительно диплоидным. Остальные

образцы были полиплоидными, при этом они являлись аллополиплоидами. В

дальнейшей своей работе мы использовали только те образцы, число хромосом и

геномная конституция которых соответствовала заявленной в каталоге видовой

принадлежности.

Ретротранспозоны. Ретроэлементы занимают значительную долю в

геномах растений и имеют большое значение в их организации. Одним из важных

вопросов

является

роль

ретроэлементов

в

процессах

алло-

и

автополлиплоидизации. Различные авторы указывали, что в ходе этих процессов

может происходить как вспышка их амплификации в геноме, так и наоборот –

снижение их количества (Petit et al., 2007; Yaakov et al., 2013) или

«выравнивание» по различным субгеномам и хромосомам (Birchler & Presting,

2012; Tsukahara et al., 2012). Также в случае аллополиплоидов одним из

интересных вопросов является количественное соотношение ретротранспозонов

между отдельными субгеномами. Ретротранспозоны могут играть важную роль в

идентификации хроматина конкретных субгеномов и служить цитогенетическими

маркерами при анализе отдаленных гибридов. В нашей работе мы изучили

количественное соотношение основных групп классов ретротранспозонов между

субгеномами исследуемого нами аллополиплоида Th. intermedium.

Для выявления ретротранспозонов на субгеномах Th. intermedium мы

использовали флуоресцентную гибридизацию in situ (FISH) на препаратах

митотических хромосом. Пробы были сделаны на основе ПЦР-продуктов трех

основных групп ретроэлементов: Ty1/copia, Ty3/gypsy и LINE. Использовались

вырожденные праймеры, опубликованные на сайте Molecular Cytogenetics

Research Group (http://www.le.ac.uk/bl/phh4/retros.htm). Размер полученного ПЦР

продукта составил 270, 300 и 410 пн на трех группах соответственно и совпал с

ожидаемым. После FISH на тех же самых метафазных пластинках после отмывки

пробы проводили геномную гибридизацию in situ (GISH), что позволило

идентифицировать субгеномную принадлежность хромосом.

По результатам FISH на Th. intermedium была выявлена гибридизация на

хромосомах Th. intermedium ретротранспозонов Ty1/copia и Ty3/gypsy, но не было

обнаружено сигнала

ретротранспозонов LINE. Группа ретротранспозонов

Ty1/copia локализовалась на всех хромосомах пырея среднего и закономерностей

локализации по субгеномам выявлено не было. Ретротранспозоны группы

8

Ty3/gypsy локализовалась на всех трех субгеномах с более интенсивным сигналом

на хромосомах, принадлежащих субгеному Jr.

По литературным данным известно, что для субгенома Jr

выявлены

специфические последовательности, имеющие родство к ретротранспозонам

Nusif-1 (Tang et al., 2011). Ретротранспозон Nusif-1 относится к Ty3/gypsy. Было

показано, что увеличение копийности данного ретротранспозона произошло еще

у предковых форм субгенома Jr. Таким образом, в наших исследованиях никаких

изменений копийности основных групп ретротранспозонов, связанных с

процессом аллополиплоидизации у Th. intermedium, методом FISH выявлено не

было. Хотя была показана различная копийность Ty3/gypsy ретротранспозона по

субгеномам Th. intermedium.

Центромерный

Ty3/gypsy

ретротранспозон.

У

растений

последовательности центромер, как правило, представлены повторяющейся

сателлитной ДНК и LTR центромерными ретротранспозонами (long terminal repeat

(LTR) centromeric retrotransposons (CR)). (Jiang et al. 1996; Miller et al. 1998;

Presting et al. 1998; Cheng et al. 2002; Zhong et al. 2002; Nagaki et al. 2003b, 2004).

У злаков семейство центромерных ретротранспозонов весьма консервативно и

относится к Ty3/gypsy. Их количество может быть различным как у отдельных

видов, так и у экотипов различных злаковых (Lee et al., 2005; Liu et al., 2008).

Количество центромерных ретротранспозонов может быть связано с уровнем

плоидности и различными изменениями (амплификация, транспозиция), которые

происходят с геномами во время процесса аллополиплоидизации (Li et al., 2013).

До

настоящего

времени

исследований

центромерных

Ty3/gypsy

ретротранспозонов

на

видах

Th. bessarabicum,

P. spicata,

D. villosum

и

Th. intermedium не проводилось.

На первом этапе данного раздела нашего исследования нами были

подобраны

праймеры

(TAID_F/R)

на

консервативный

участок

обратной

транскриптазы центромерных Ty3/gypsy ретротранспозонов злаков: TAID_F 5’–

TGGTACTTGGCGTCTGTGTG –3’, TAID_R 5’– CTCGATTCCCTGTGGAGTA –3’

(совместно с И.В.Кировым).

Размер полученного ПЦР продукта составил 490 пн. на всех образцах и

совпал с ожидаемым. Амплифицированные фрагменты были клонированы и

секвенированы (не менее 20 клонов для каждого вида). В общей сложности было

получено следующее количество уникальных последовательностей для каждого

из видов: Th. bessarabicum – 4, Th. intermedium – 9, P. spicata – 5, and D. villosum

6. Все они были размещены в GenBank под соответствующими номерами

KR873398-KR873420. Выявленные аллельные варианты нуклеотидов были нами

обозначены как RT-CR (reverse transcriptase of centromeric retrotransposons).

BLAST-анализ показал высокую степень их гомологии к центромерным

ретротранспозонам

злаков.

Выравнивание

полученных

в

нашей

работе

нуклеотидных последовательностей показало, что все они имеют высокую

степень гомологии друг к другу.

Предполагаемые аминокислотные последовательности были получены на

основе

нуклеотидных

последовательностей.

Филогенетическое

дерево

(дендрограмма)

было

построено

после

выравнивания

аминокислотных

9

P. spicata

RT-CR

формировали

отдельную

группу

транспозонами риса (CRR) и кукурузы (CRM) (группа 2).

с

центромерными

Рисунок 1. Дендрограмма аминокислотных последовательностей RT-CR и их гомологов из базы

данных

NCBI

GenBank.

Дендрограмма

была

построена

с

использованием

метода

максимального правдоподобия на основе матричной модели на основе JTT. Бутстреп 1000.

Цветные маркеры указывают RT-CR, полученные в настоящем исследовании.

Для

определения

локализации

последовательности

центромерного

Ty3/gypsy ретротранспозона была выполнена FISH на митотических хромосомах

Th. intermedium, Th. bessarabicum, P. spicata и D. villosum с мечеными ПЦР

продуктами, которые были амплифицированы с ДНК-матриц соответствующих

видов с использованием праймеров TAID_F/R. В результате FISH пробы

центромерного

ретротранспозона,

полученные

из

диплоидных

видов,

гибридизовались с центромерной областью всех хромосом соответствующих

видов. В Th. intermedium сигнал был обнаружен на всех хромосомах, но его

интенсивность достоверно варьировалась между отдельными хромосомами, что

наблюдалось на всех проанализированных метафазных пластинках (рис. 2): пять

хромосом несли более интенсивный сигнал, восемь хромосом несли более слабый

сигнал по сравнению с остальными хромосомами. Остальные хромосомы

Th. intermedium обладали промежуточным уровнем сигнала. Чтобы установить,

обусловлены ли различия в интенсивности сигнала геномной специфичностью

пробы или различием в копийности ретротранспозонов, мы проводили FISH на

метафазных

пластинках

хромосом

Th. intermedium

с

одновременным

10

последовательностей обратной транскриптазы доменов известных центромерных

повторов риса (DQ458289.1), кукурузы (AAM94350.1), пшеницы (ABI96971.1) и

ячменя (AAK94517.1) с полученными в нашей работе последовательностями

центромерного

Ty3/gypsy

ретротранспозона

с

помощью

программного

обеспечения Mega 6.0 (рис. 1). RT-CR Th. intermedium, Th. bessarabicum,

D. villosum и один аллель из P. spicata попали в одну группу с центромерными

ретротранспозонами пшеницы (CRW) и ячменя (Cereba) (группа 1). Три аллеля

использованием двух проб в трёх комбинациях: 1) Th. bessarabicum и P. spicata

(рис. 2a и рис. 2b), 2) P. spicata и D. villosum, 3) Th. bessarabicum и D. villosum. В

результате всех трёх экспериментов FISH были обнаружены сильные сигналы на

пяти хромосомах и слабые сигналы на восьми одних и тех же хромосомах

Th. intermedium. В наших экспериментах с помощью mcGISH у Th. intermedium

(PI 401200) было выявлено 14 хромосом субгенома Jr, 14 хромосом субгенома St

(одна с транслокацией) и 14 хромосом субгенома Jvs. Субгеном Jvs состоял из пяти

хромосом с St сигналом в субтеломере (обозначены Jv) и девяти хромосом с

субтеломерными и прицентромерными St сигналами (обозначены Js) (рис. 2с).

Kishii et al. (2005), Mahelka et al. (2011), Deng et al. (2013) и Tang et al. (2011)

показали в своих работах, что число хромосом субгенома Js варьируется у

Th. intermedium от восьми до десяти.

Сравнение метафазных пластинок FISH и GISH показало, что самые

сильные сигналы ПЦР-проб RT-CR наблюдаются на пяти хромосомах субгенома

Jv. Самый слабый сигнал несли четыре St-хромосомы и четыре хромосомы

субгенома Js. Другие хромосомы имеют промежуточную интенсивность сигнала.

Следует отметить, что сигнал на хромосомах субгенома Jr в среднем был сильнее,

чем на хромосомах субгенома St (рис. 2a, 2b и 2c).

Рисунок 2. Гибридизация in situ на одной и той же метафазной пластинке Th. intermedium: (a)

FISH, проба Th. bessarabicum центромерного Ty3/gypsy ретротранспозона (биотин, розовый

цвет); (b) FISH, проба P. spicata центромерного Ty3/gypsy ретротранспозона (DIG, зеленый

цвет); (с) mcGISH, пробы: геномная ДНК D. villosum (биотин, розовый цвет) и геномная ДНК

P. spicata (DIG, зеленый цвет), блок – мягкая пшеница. Контр-окрашивание DAPI (синий цвет).

Шкала = 10 µm.

Таким образом, разница в интенсивности сигнала между хромосомами

обусловлена не геномной специфичностью получаемого в результате ПЦР

продукта с праймерами TAID_F/R с одного из трех субгеномов Th. intermedium, а

различным количеством копий центромерных Ty3/gypsy ретротранспозонов на

отдельных хромосомах.

Пшеница сорта Тулайковская 100, полученная в результате отдалённой

гибридизации, имеет замещение хромосомы 6D на гомеологичную хромосому

6Ai#2 Th. intermedium. По результатам геномной in situ гибридизации с геномной

ДНК P. spicata и D. villosum хромосому 6Ai#2 мы отнесли к субгеному Jr(=Е).

Также мы провели FISH на хромосомах пшеницы сорта Тулайковская 100 с

пробой центромерного Ty3/gypsy ретротранспозона, полученной в результате ПЦР

11

с праймерами TAID_F/R на ДНК Th. intermedium. FISH сигнал был обнаружен на

всех хромосомах, но его интенсивность несколько варьировалась между

отдельными хромосомами (рис. 3a). Тем не менее наблюдаемое изменение

интенсивности

сигнала между хромосомами

Т. aestivum

было

не столь

значительно, как у Th. intermedium. Чтобы определить две замещенные

хромосомы Th. intermedium, мы проводили последовательные FISH/GISH (рис.

3b). В результате было показано, что сигнал центромерного повтора на

хромосомах Th. intermedium был слабым и по интенсивности соответствовал

самым слабым сигналам на хромосомах пшеницы.

Рисунок 3. Гибридизация in situ на одной и той же метафазной пластинке пшеницы сорта

Тулайковская 100: (a) FISH, проба Th. intermedium центромерного Ty3/gypsy ретротранспозона

(биотин, розовый цвет); (b) mcGISH, пробы: геномная ДНК D. villosum (биотин, розовый цвет,

сигнал отсутствует) и геномная ДНК P. spicata (DIG, зеленый цвет), блок – мягкая пшеница.

Контр-окрашивание DAPI (синий цвет). Стрелками показана пара замещённых хромосом 6Jr

пырея среднего.

ПЦР в реальном времени. Наряду с FISH, Саузерн-блот гибридизацией и

дот-блот анализом, одним из надежных подходов к оценке относительного

количества копий повторяющих элементов в геноме является количественная

ПЦР в реальном времени (qPCR) (Belyayev et al., 2010; Kraitshtein et al., 2010).

Эффективность использования qPCR для анализа динамики и изменения

количества копий повторяющих элементов была показана на Aegilops и видах

рода Triticum (Belyayev et al., 2010; Kraitshtein et al., 2010; Yaakov et al., 2013). Тем

не менее копийность центромерного Ty3/gypsy ретротранспозона с помощью

qPCR анализа на других видах Triticeae еще не изучена.

Мы провели qPCR с комбинацией праймеров TAID_F/R на геномной ДНК

Th. bessarabicum,

Th. intermedium,

P. spicata

и

D. villosum

и

оценили

относительное количество копий RT-CR. Анализ показал, что копийность в

геноме Th. bessarabicum и P. spicata ~ в 3 раза больше, чем в геноме в D. villosum.

Копийность в геноме гексаплоидного аллополиплоида Th. intermedium ~ в 11 раз

больше, чем в геноме в D. villosum. Таким образом, qPCR показал, что D. villosum

(потенциальный донор субгенома Jvs) имел меньшее количество копий RT-CR,

чем кандидаты в доноры субгенома Jb (Th. bessarabicum) и субгенома St

(P. spicata). В то же время FISH на Th. intermedium показал, что пять Jv хромосом

несут большее количество RT-CR, чем другие хромосомы. qPCR не выявила

существенной разницы между Th. bessarabicum и P. spicata в количестве RТ-CR.

12

В целом, FISH сигнал RT-CR на хромосомах субгенома Jr был сильнее, чем на

хромосомах субгенома St. Если D. villosum, Th. bessarabicum, P. spicata являются

донорами геномов Th. intermedium (или очень близки к ним), то различие по

интенсивности сигнала в центромерных регионах хромосом Th. intermedium не

может быть объяснено разницей в количестве центромерных ретротранспозонов в

донорах субгеномов Th. intermedium. Таким образом, результаты анализа qPCR на

Th. intermedium и видов с родственными ему геномами ([Jb≈(JrJvsSt)/3≈St] V) не

могут объяснить наблюдаемую разницу интенсивности сигнала в центромерах

различных хромосом Th. intermedium, выявленную FISH: (JvJr[Js≈St]). Можно

предположить, что активация центромерных ретротранспозонов в Th. intermedium

могла произойти после и/или в результате полиплоидизации при образовании

этого

вида.

Такие

изменения

могли

оказаться

определяющими

для

дифференциации субгеномов

Th. intermedium после полиплоидизации для

обеспечения правильной конъюгации хромосом и их расхождения в мейозе.

Тандемные повторы. Тандемные повторы формируют значительную часть

генома растений. Большое значение получило цитогенетическое маркирование

хромосом, плеч хромосом и отдельных их участков с помощью локализации

тандемных повторов in situ. Данные маркеры широко применяются как в

фундаментальных, так и прикладных исследованиях. Для

создания

новых

цитогенетических маркеров у изучаемых нами видов злаков Th. bessarabicum (Jb),

P. spicata (St), D. villosum (V), Th. intermedium (JrJvsSt) нами были использованы

тандемно-организованные повторяющиеся последовательности ДНК, выявленные

нами на основе анализа баз данных полногеномного секвенирования NGS

T. aestivum. Биоинформационный анализ проводился совместно с лабораторией

биоинформатики ФГБУ ФНКЦ ФХМ ФМБА России. В целом работу,

проведенную нами, можно разделить на несколько последовательных этапов.

Первым этапом было выявление тандемных высококопийных повторов из

существующей базы данных нуклеотидных последовательностей T. aestivum с

помощью

программы

Tandemrepeat

Finder.

Данный

этап

проводился

в

лаборатории биоинформатики ФГБУ ФНКЦ ФХМ ФМБА РФ. В диссертации

представлены

только

результаты

данной

работы

название

повтора,

нуклеотидная последовательность, размер мономера, копийность в геноме мягкой

пшеницы.

Второй этап состоял в проведении BLAST анализа наиболее перспективных

(высококопийных) последовательностей ДНК.

Третьим этапом был подбор праймеров для амплификации выявленных

повторов.

Четвертый этап включал ПЦР анализ с помощью разработанных праймеров

всех исследуемых видов и мягкой пшеницы.

Пятый этап заключался в проведении флуоресцентной гибридизации in situ с

мечеными ПЦР продуктами на препаратах митотических хромосом пшеницы и ее

дикорастущих сородичей. Дополнительно на метафазных пластинках Th. intermedium

(JrJvsSt) после отмывки препаратов проводилась геномная in situ гибридизация для

выявления субгеномной принадлежности хромосом пырея среднего. В результате

положительные результаты по локализации на хромосомах дикорастущих злаков были

13

получены для семи тандемно-организованных повторов, выявленных в геноме мягкой

пшеницы.

Повтор П720 имеет размер мономера 295 пн. Его непрерывная копийность

в контигах мягкой пшеницы составляет 320. В базе данных выявлена гомология с

повтором pTa-173 с размером мономера 337 пн (Komuro et al., 2013). С помощью

программы Primer3web мы подобрали праймеры П720F/R.

В результате FISH гибридизации проба повтора П720, полученная из

диплоидных видов, гибридизовалась на всех хромосомах трех видов. На трех

диплоидных видах дикорастущих сородичей пшеницы сигнал локализовался в

субтеломерной области хромосом. У Th. bessarabicum имелся дополнительный

сайт локализации на одной паре хромосом на коротком плече (рис. 4a, показаны

стрелками). У D. villosum наблюдались сайты дополнительной локализации

сигнала в прицентромерной области на различных плечах хромосом: четыре пары

хромосом имели дополнительные сигналы в прицентромерной области, две пары

– на разных плечах (рис. 4b). У P. spicata имелся дополнительный сайт

локализации на одной паре хромосом на длинном плече (рис. 4с).

В результате FISH на Th. intermedium (JrJvsSt) с использованием пробы

повтора П720 сигнал был обнаружен на всех хромосомах. Сигналы были

локализованы в основном в субтеломерных областях хромосом, дополнительно

двенадцать хромосом имели сигналы в центромерном и прицентромерном

регионах. Четыре хромосомы генома Jv и четыре хромосомы генома Js имеют

сигналы в центромерном и прицентромерной участке (рис. 4d и 4e, показаны

стрелками). Эти сигналы схожи с сигналами, локализованными на D. villosum. Это

служит одним из аргументов в пользу того, что возможным донором Jvs генома у

Th. intermedium был D. villosum или одна из его предковых форм. Также сигналы

двух хромосом генома Jr и двух хромосом генома St были локализованы в

прицентромерной области хромосом.

Рисунок 4. FISH локализация повтора П720. (a) Th. bessarabicum, (b) D. villosum, (c) P. spicata,

(d) Th. intermedium. Пробы помечены биотин-16-dUTP (розовый цвет) (e) mcGISH на

метафазной пластинке Th. intermedium, пробы: геномная ДНК D. villosum (биотин, розовый

цвет) и геномная ДНК P. spicata (DIG, зеленый цвет), блок – мягкая пшеница. Контр-

окрашивание DAPI (синий цвет). Стрелками показаны дополнительные сайты локализации на

хромосомах.

14

Повтор П170 имеет размер мономера 273 пн. Его непрерывная копийность

в контигах мягкой пшеницы составляет 334. В базе данных NCBI гомологии к

охарактеризованным нуклеотидным последовательностям выявлено не было.

Были подобраны праймеры П170F/R.

В связи с тем, что гомологичных сателлитных последовательностей к

данному повтору выявлено не было, вначале мы проводили гибридизацию на

хромосомах мягкой пшеницы. На пшенице сорта Иволга сигнал повтора П170

четко локализовался на 10 хромосомах – на двух в прицентромерной области, на

двух интерстициально на коротком плече, на двух интерстициально обоих плеч,

на двух дистально на длинном плече, на двух дистально и интерстициально на

длинном плече

Среди трех диплоидных видов дикорастущих сородичей пшеницы повтор

П170 локализовался только на трех парах хромосом Th. bessarabicum в

субтеломерной области (рис. 5a). Среди трех пар хромосом одна пара имеет

сигнал в субтеломерной области короткого плеча. Одна пара имеет сигналы в

субтеломерной области длинного плеча. Одна пара имеет сигналы на обоих

плечах.

На Th. intermedium (JrJvsSt) повтор П170 локализовался только на одной паре

хромосом Jr генома в прицентромерной области короткого плеча (рис. 5b, 5c,

показаны стрелками).

Рисунок 5. FISH локализация повтора П170. (a) Th. bessarabicum, (b) Th. intermedium. Пробы

помечены

биотин-16-dUTP

(розовый

цвет).

(с)

mcGISH

на

метафазной

пластинке

Th. intermedium, пробы: геномная ДНК D. villosum (биотин, розовый цвет) и геномная ДНК

P. spicata (DIG, зеленый цвет), блок – мягкая пшеница. Контр-окрашивание DAPI (синий цвет).

Стрелками показаны хромосомы, имеющие сигналы.

Повтор П332 имеет размер мономера 73 пн. Его непрерывная копийность в

контигах мягкой пшеницы составляет 946. В базе данных NCBI была выявлена

гомология с тандемным повтором pTa-k566 размером 72 пн (Komuro et al., 2013).

В нашем опыте на данный повтор праймеров подобрать не удалось. В качестве

пробы для FISH использовался синтезированный олигонуклеотид размером 36 пн,

меченный биотин-16-dUTP.

На пшенице повтор П332 локализовался на плечах 14 хромосом. Результаты

FISH гибридизации повтора П332 на пшенице совпали с результатами,

15

полученными в работе Komuro c соавт. (2013) на повторе pTa – k566. Среди трех

диплоидных видов дикорастущих повтор П332 гибридизовался только на

D. villosum. Сигнал был локализован на двух парах хромосом: в прицентромерной

области одной пары и на длинном плече другой пары интерстициально (рис. 6a,

показаны стрелками).

Рисунок 6. FISH локализация повтора П332. (a) D. villosum (b) Th. intermedium. Проба –

синтезированый олигонуклеотид, меченный биотин-16-dUTP (розовый цвет). (c) mcGISH на

метафазной пластинке Th. intermedium, пробы: геномная ДНК D. villosum (биотин, розовый

цвет) и геномная ДНК P. spicata (DIG, зеленый цвет), блок – мягкая пшеница. Контр-

окрашивание DAPI (синий цвет). Стрелками показаны хромосомы, имеющие сигналы.

В результате FISH гибридизации повтора П332 на Th. intermedium (JrJvsSt),

сигнал был обнаружен на одной паре хромосом субгенома Js. Сигнал

локализовался в прицентромерной области длинного плеча (рис. 6b, показан

стрелками). При этом сайты локализации приходились на хроматин, который

имел родство (гибридизовался при mсGISH) с геномом D. villosum. Отсутствие

второй пары хромосом у Th. intermedium может быть объяснено вовлечением

этого участка в рекомбинацию, при которой V-геном-подобный хроматин

заместился на хроматин генома St.

Повтор П631 имеет размер мономера 317 пн. Его непрерывная копийность

в контигах мягкой пшеницы составляет 387. В базе данных NCBI была выявлена

гомология к повтору pTa-451 (Komuro et al., 2013). Были подобраны праймеры

П631F/R.

На пшенице сорта Иволга повтор П631 локализовался на 14 хромосомах в

прицентромерном участке. Результаты FISH гибридизации повтора П631 на

пшенице совпали с результатами, полученными в работе Komuro c соавт. (2013)

на повторе pTa-451. Повтор П631 гибридизовался на четырех хромосомах

P. spicata в прицентромерном участке (рис. 7a). На хромосомах D. villosum

сигнала обнаружено не было. На хромосомах Th. bessarabicum сигналы были

диспергированы на всех хромосомах. При этом интенсивность сигнала была выше

в прицентромерной области (рис. 7b). Распределение сигнала при FISH

характерно

для

гибридизации

с

пулом

ретротранспозоновых

последовательностей.

16

Рисунок 7. FISH локализация повтора П631. (a) P. spicata (DIG, зеленый цвет), (b)

Th. bessarabicum (биотин, розовый цвет), (c) Th. intermedium (биотин, розовый цвет). (d)

mcGISH на метафазной пластинке Th. intermedium, пробы: геномная ДНК D. villosum (биотин,

розовый цвет) и геномная ДНК P. spicata (DIG, зеленый цвет), блок – мягкая пшеница. Контр-

окрашивание DAPI (синий цвет). Стрелками показаны хромосомы, имеющие сигналы.

В связи с этим мы можем выдвинуть две гипотезы. Первая заключается в

том, что определенная часть повтора гомологична той или иной части

ретротранспозона,

получившего

широкое

распространение

в

геноме

Th. bessarabicum. Поэтому при получении пробы с пула амплифицированных

фрагментов метится в том числе и участок ретротранспозона, что и дает

наблюдаемую картину распределения сигнала. Вторая гипотеза заключается в

том, что при копировании и распространении ретротранспозонов по геному

Th. bessarabicum они захватили определенную часть повтора (часть мономера,

целый мономер, или даже несколько), и распространили его по всему телу

хромосомы.

В результате FISH гибридизации повтора П631 на Th. intermedium (JrJvsSt)

был обнаружен сигнал на 20 хромосомах в прицентромерной области. Чтобы

определить, к каким субгеномам относятся хромосомы со специфичными

сигналами, мы проводили mcGISH на той же метафазной пластинке после

отмывки. На Th. intermedium сигнал обнаруживался на 14 хромосомах Jr генома,

четырех хромосомах Jv генома и четырех хромосомах St генома (рис. 7c и 7d).

Повтор П523 имеет размер мономера 501 пн. Его непрерывная копийность

в контигах мягкой пшеницы составляет 6. В базе данных гомологии к

охарактеризованным нуклеотидным последовательностям выявлено не было.

Были подобраны праймеры П523F/R.

По результатам FISH не было выявлено локализации повтора П523 на

хромосомах пшеницы сорта Иволга, а также на диплоидных видах. На

гексаплоидном виде Th. intermedium (JrJvsSt) был обнаружен сигнал повтора П523

на двух хромосомах Js генома в центромерном участке (рис. 8a и 8b). Согласно

результатам GISH на той же метафазной пластинке, две хромосомы с сигналом в

центромерной области относятся к рекомбинантному геному Js. При этом повтор

локализовался в хроматине, относящемуся к геному St.

17

Рисунок 8. Гибридизация in situ на хромосомах Th. Intermedium. (a) FISH локализация повтора

П523 (биотин, розовый цвет), контро-крашивание DAPI (синий цвет). (b) GISH: проба –

меченая дигоксигенин-11-dUTP ДНК P. spicata (St геном, зеленый цвет), блок – мягкая пшеница

(ABD геном, красный цвет). Стрелками показаны хромосомы, имеющие сигналы.

Повтор П431 имеет размер мономера 252 пн. Его непрерывная копийность

в контигах мягкой пшеницы составляет 333 раз. В базе данных NCBI гомологии к

охарактеризованным нуклеотидным последовательностям выявлено не было.

Были подобраны праймеры П431F/R.

По результатам FISH не было обнаружено сигнала повтора П431 на

хромосомах пшеницы сорта Иволга, а также на хромосомах P. spicata и

D. villosum.

Среди

диплоидных

видов

повтор

локализовался

только

на

Th. bessarabicum по всей длине хромосом, за исключением субтеломерных

участков (рис. 9a).

Рисунок 9. FISH локализация повтора П431. (a) Th. bessarabicum (биотин, розовый цвет), (b)

Th. intermedium (биотин, розовый цвет), (c) mcGISH на метафазной пластинке Th. intermedium,

пробы: геномная ДНК D. villosum (биотин, розовый цвет) и геномная ДНК P. spicata (DIG,

зеленый цвет), блок – мягкая пшеница. Контр-окрашивание DAPI (синий цвет)

На Th. intermedium (JrJvsSt) сигнал был обнаружен на 14 хромосомах

субгенома Jr с распределением по всей длине хромосом, за исключением

субтеломерных участков (рис. 9b и 9c).

18

Повтор П496 имеет размер мономера 53 пн. Этот повтор является самым

коротким среди других повторов, использовавшихся в нашем исследовании, и

имеет

высокую

копийность

(743).

В

базе

данных

гомологии

к

охарактеризованным

нуклеотидным

последовательностям

повторов

П496

выявлено не было. Ввиду малого размера повтора П496 мы использовали

меченные биотином олигонуклеотиды размером 33 пн в качестве пробы для FISH.

По результатам FISH и GISH гибридизации на метафазных пластинках

дикорастущих сородичей пшеницы у повтора П496 была выявлена схожая

локализация с повтором П431. На хромосомах Th. bessarabicum и Th. intermedium

FISH сигнал был обнаружен на 14 хромосомах по всей длине хромосомы, за

исключением субтеломерных участков (рис. 10a). Согласно результатам GISH, 14

хромосом Th. intermedium, несущие сигнал повтора П496, принадлежат к Jr

геному. На пшенице сорта Иволга повтор П496 локализовался на двенадцати

хромосомах: в прицентромерной области двух пар, интерциально на длинном

плече двух пар и в субтеломерной регионе короткого плеча двух пар хромосом

(рис. 10b, показаны стрелками).

Рисунок 10. FISH локализация повтора П496. (a) Th. intermedium меченой (биотин, розовый

цвет), (b) T. aestivum (биотин, розовый цвет). Контр-окрашивание DAPI (синий цвет).

Стрелками показаны хромосомы, имеющие сигналы.

Заключение.

Несмотря

на

активное

использование

дикорастущих

сородичей пшеницы в отдаленной гибридизации их геномы остаются слабо

изученными. Полученные в нашей работе результаты могут позволить повысить

эффективность интрогрессии хозяйственно-ценных генов изученных видов в

геном пшеницы. Цитогенетические маркеры, выявленные нами, позволят лучше

понять эволюцию геномов диплоидных видов Th. bessarabicum (Jb), P. spicata (St),

D. villosum (V) и гексаплоидного вида Th. intermedium (JrJvsSt). Кроме того,

полученные данные могут быть использованы при секвенировании, сборке и

аннотации их геномов.

ВЫВОДЫ

1. Методом FISH с использованием гетерогенных ПЦР проб показано, что

копийность

Ty3/gypsy

ретротранспозонов

выше

в

субгеноме

Jr

аллогексаплоида Th. intermedium (JrStJvs). Для Ty1/copia ретротранспозона

различий по копийности в субгеномах Th intermedium не выявлено.

19

2. Методом

FISH

выявлена

локализация

центромерных

Ty3/gypsy

ретротранспозонов

в

центромерных

регионах

всех

хромосом

у

Th. bessarabicum (Jb), P. spicata (St), D. villosum (V) и Th. intermedium

(JrStJvs). Анализ нуклеотидных последовательностей и результаты FISH

показали

высокую

консервативность

гена

обратной

транскриптазы

центромерных Ty3/gypsy ретротранспозонов у всех исследуемых видов.

3. Методом количественной ПЦР показано, что копийность центромерных

Ty3/gypsy ретротранспозонов в пересчете на субгеном у Th. intermedium

(JrStJvs), Th. bessarabicum (Jb) и P. spicata (St) приблизительно в 3 раза

больше, чем в геноме D. villosum (V). Методом FISH показаны различия в

копийности

центромерного

Ty-3/gypsy

ретротранспозона

между

субгеномами аллогексаплоида Th. intermedium Jv Jr [Js≈St].

4. Показана возможность использования тандемных повторов (на примере

П720, П170, П332, П631, П523, П431 и П496), выявленных методами

биоинформатики на основе баз данных полногеномного секвенирования

мягкой пшеницы, в качестве молекулярно-цитогенетических маркеров для

отдельных хромосом и субгеномов дикорастущих видов с различным

геномным составом (Th. bessarabicum (Jb), P. spicata (St), D. villosum (V) и

Th. intermedium (JrStJvs)) и форм пшеницы, полученных с их участием.

5. На

хромосомах

Th. bessarabicum

(Jb)

методом

FISH

локализуются

следующие повторы: П720 – в субтеломерном регионе всех 14 хромосом, а

также в середине короткого плеча одной из пар хромосом; П170 - в

субтеломерном регионе на коротком и длинном плече одной пары

хромосом, в субтеломерном регионе на коротком плече одной пары

хромосом, в субтеломерном регионе на длинном плече одной пары

хромосом; П631, П431 и П496 – диспергированно на всех 14 хромосомах по

всей длине кроме субтеломерной области.

6. На хромосомах P. spicata (St) методом FISH локализуются следующие

повторы: П720 – дистально на длинном плече одной пары и в

субтеломерном регионе всех 14 хромосом; П631 – в прицентромерной

области двух пар хромосом.

7. На хромосомах D. villosum (V) методом FISH локализуются следующие

повторы: П720 – на разных плечах и в прицентромерной области четырех

пар, на разных плечах двух пар и в субтеломерном регионе всех 14

хромосом;

П322

в

прицентромерной

области

одной

пары

и

интерстициально на длинном плече одной пары хромосом.

8. На хромосомах Th. intermedium (JrStJvs) методом FISH локализуются

следующие повторы: П720, П170, П322, П631, П523, П431 и П496. П720

локализуются в прицентромерной области семи пар (одна пара субгенома

(Jr), одна пара субгенома (St) и четыре пары субгенома (Jvs), дистально на

длинном плече одной пары субгенома (Jvs) и в субтеломерном регионе всех

хромосом). П170 локализуется в прицентромерной области одной пары

хромосом субгенома (Jr). П322 локализуется интерстициально на длинном

плече одной пары хромосом субгенома (Jvs). П631 локализуется в

прицентромерной области двух пар хромосом субгенома (St), двух пар

20

П496

показали

распределение

по

всей

длине

хромосомы,

субтеломерной области на 7 парах хромосом субгенома (Jr).

кроме

9. Впервые показана локализация выявленных нами двух тандемных повторов

на хромосомах мягкой пшеницы: П170 локализуется на пяти парах

хромосом (в прицентромерной области одной пары, интерстициально на

коротком плече одной пары, интерстициально на обоих плечах одной пары,

дистально на длинном плече одной пары, дистально и интерстициально на

длинном плече одной пары); П496 локализуется на шести парах хромосом

(в прицентромерной области двух пар, интерстициально на длинном плече

двух пар и в субтеломерной регионе короткого плеча двух пар хромосом).

Данные повторы могут служить дополнительными цитогенетическими

маркерами для хромосом мягкой пшеницы.

Список публикаций по теме диссертации

Статьи в журналах перечня ВАК:

1. Khuat, T.M.L. Differences in ploidy level and genome constitution revealed

by cytogenetic analysis of Pseudoroegneria germplasm accessions: case study / T.M.L.

Khuat, M.G. Divashuk, P.Yu. Kroupin, P.A. Nguyen, A.V. Kiseleva, G.I. Karlov //

Изв. Тимирязевской с.–х. акад. 2015. № 2. С. 29 35.

2. Salina, E.A. A Thinopyrum intermedium chromosome in bread wheat cultivars

as a source of genes conferring resistance to fungal diseases / E.A. Salina, I.G. Adonina,

E.D. Badaeva, P.Yu. Kroupin, A.I. Stasyuk, I.N. Leonova, A.A. Shishkina, M.G.

Divashuk, E.V. Starikova, T.M.L. Khuat, V.V. Syukov, G.I. Karlov // Euphytica.

2015. № 204. – С. 91 101.

3. Крупин, П.Ю. Полиморфизм реакции проростков пшенично – пырейных

гибридов на засоление / П.Ю. Крупин, М.Г. Дивашук, М.С. Баженов, Л.А.

Гриценко, И.Г. Тараканов, В.П. Упелниек, В.И. Белов, А.А. Почтовый, Е.В.

Старикова, Т.М.Л. Кхуат, М.В. Климушина, А.Н. Давыдова, Г.И. Карлов //

Сельскохозяйственная биология. 2013. – № 5. С. 44 53.

Тезисы и материалы конференций:

4. Khuat, T.M.L. Comparative chromosome organization of repeated DNA in

Thinopyrum bessarabicum, Pseudoroegneria spicata and Thinopyrum intermedium /

T.M.L Khuat, M. Divashuk, A. Zelenin, D. Alexeev, P. Kroupin, G. Karlov // Plant

Molecular Cytogenetics in Genomic and Postgenomic Era. – 2014. – P. 71.

5. Карлов, Г.И. Mолекулярная цитогенетика в интеграции геномных

данных/ Г.И. Карлов, М.Г. Дивашук, О.С. Александров, О.В. Разумова, Тхи Май

Л Кхуат // VI съезд Вавиловского общества генетиков и селекционеров (ВОГиС)

и ассоциированные генетические симпозиумы г. Ростов-на-Дону, 15–20 июня

2014 г – с. 130

21

хромосом субгенома (Jvs), на 7 парах хромосом субгенома (Jr) распределен

по длине хромосомы, кроме субтеломерной области и имеет более яркие

сигналы

в

прицентромерной

области.

П523

локализуется

в

прицентромерной области одной пары хромосом субгенома (Jvs). П431 и

Благодарности

Автор

выражает

огромную

признательность

своему

научному

руководителю, к.б.н., с.н.с. Михаилу Георгиевичу Дивашуку за помощь в

написании и проведении этой работы. Благодарю всех сотрудников Центра

молекулярной биотехнологии, в особенности профессора, д.б.н., руководителя

Центра молекулярной биотехнологии Геннадия Ильича Карлова за помощь в

проведении экспериментов, консультации и научные дискуссии, и к.б.н., с.н.с.

Павла Юрьевича Крупина за техническую помощь в обработке данных и

оформлении доклада. Выражаю благодарность за совместную продуктивную

работу заведующему лабораторией Биоинформатики ФГБУ ФНКЦ ФХМ ФМБА

России Д.Г. Алексееву. Благодарю своих друзей и коллег за всестороннюю

поддержку.

22



 
Похожие работы:

«ШВЫРЕВА УЛЬЯНА СЕРГЕЕВНА СТРУКТУРНО-ФЦНКЦИОНАЛЬНЫЙ АНАЛИЗ РЕГУЛЯТОРНОЙ ОБЛАСТИ ГЕНА dps E. coli 03.00.03 – Молекулярная биология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Пущино-2016 доктор биологических наук, профессор Озолинь Ольга Николаевна кандидат биологических наук Тутукина Мария Николаевна доктор биологических наук, профессор Гельфанд Михаил Сергеевич (заместитель директора по научным Научные руководители: Официальные оппоненты:...»

«УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ ВИТЕБСКИЙ ГОСУДАРСТВЕННЫЙ ОРДЕНА ДРУЖБЫ НАРОДОВ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ УДК 618.145:616-007.61-07-084 ЛЫСЕНКО Ольга Викторовна ГИПЕРПЛАСТИЧЕСКИЕ ПРОЦЕССЫ ЭНДОМЕТРИЯ: КЛИНИКА, ДИАГНОСТИКА, ПРОФИЛАКТИКА И ЛЕЧЕНИЕ Автореферат диссертации на соискание ученой степени доктора медицинских наук по специальности 14.01.01 – акушерство и гинекология Витебск, 2015 Официальные оппоненты: Оппонирующая организация: Воскресенский Сергей Львович, доктор медицинских наук, профессор,...»

«Одинец Алексей Глебович НОВЫЕ ПОДХОДЫ В БИОТЕХНОЛОГИИ ПРИ ПРОИЗВОДСТВЕ ПРОДУКТОВ ДЛЯ ДИЕТИЧЕСКОГО ПИТАНИЯ ИЗ БУРЫХ МОРСКИХ ВОДОРОСЛЕЙ 03.01.06 – Биотехнология (в том числе бионанотехнологии) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2015 1 Член-корреспондент РАН, доктор медицинских наук Доктор медицинских наук, профессор Официальные оппоненты: Доктор биологических наук, профессор главный научный сотрудник кафедры гидробиологии...»





 
© 2015 www.z-pdf.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.